ID: 907300013

View in Genome Browser
Species Human (GRCh38)
Location 1:53481235-53481257
Sequence CTTTGGGGCTCTCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907300013_907300022 12 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300022 1:53481270-53481292 CTCCCCACAGGTCAGCCTCCTGG No data
907300013_907300019 0 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300019 1:53481258-53481280 CCCCTTGATGCACTCCCCACAGG No data
907300013_907300028 26 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300028 1:53481284-53481306 GCCTCCTGGGGCACAGAGCAAGG No data
907300013_907300032 30 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300032 1:53481288-53481310 CCTGGGGCACAGAGCAAGGGAGG No data
907300013_907300023 13 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300023 1:53481271-53481293 TCCCCACAGGTCAGCCTCCTGGG No data
907300013_907300030 27 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300030 1:53481285-53481307 CCTCCTGGGGCACAGAGCAAGGG No data
907300013_907300025 14 Left 907300013 1:53481235-53481257 CCAGAAGCCAGAGAGCCCCAAAG No data
Right 907300025 1:53481272-53481294 CCCCACAGGTCAGCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907300013 Original CRISPR CTTTGGGGCTCTCTGGCTTC TGG (reversed) Intergenic
No off target data available for this crispr