ID: 907301226

View in Genome Browser
Species Human (GRCh38)
Location 1:53487494-53487516
Sequence GCCATCATGCTTCTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907301222_907301226 -5 Left 907301222 1:53487476-53487498 CCAGTGTTCATCCTTCCTGCCAT No data
Right 907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG No data
907301220_907301226 22 Left 907301220 1:53487449-53487471 CCTCTTGAGAGTCAGCGTGGTAA No data
Right 907301226 1:53487494-53487516 GCCATCATGCTTCTGGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907301226 Original CRISPR GCCATCATGCTTCTGGTCAC TGG Intergenic
No off target data available for this crispr