ID: 907301232

View in Genome Browser
Species Human (GRCh38)
Location 1:53487521-53487543
Sequence AAGAGTGACCTGGCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907301223_907301232 11 Left 907301223 1:53487487-53487509 CCTTCCTGCCATCATGCTTCTGG No data
Right 907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG No data
907301222_907301232 22 Left 907301222 1:53487476-53487498 CCAGTGTTCATCCTTCCTGCCAT No data
Right 907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG No data
907301227_907301232 3 Left 907301227 1:53487495-53487517 CCATCATGCTTCTGGTCACTGGC No data
Right 907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG No data
907301225_907301232 7 Left 907301225 1:53487491-53487513 CCTGCCATCATGCTTCTGGTCAC No data
Right 907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907301232 Original CRISPR AAGAGTGACCTGGCAGTGGA GGG Intergenic
No off target data available for this crispr