ID: 907302322

View in Genome Browser
Species Human (GRCh38)
Location 1:53496095-53496117
Sequence CCAGAGTCTTTCAGGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907302322_907302328 0 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302328 1:53496118-53496140 GGTCTTGAGACCCAGAAGTTGGG No data
907302322_907302332 13 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302332 1:53496131-53496153 AGAAGTTGGGGCCTTCTCCCAGG No data
907302322_907302335 19 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302335 1:53496137-53496159 TGGGGCCTTCTCCCAGGATGGGG No data
907302322_907302333 17 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302333 1:53496135-53496157 GTTGGGGCCTTCTCCCAGGATGG No data
907302322_907302334 18 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302334 1:53496136-53496158 TTGGGGCCTTCTCCCAGGATGGG No data
907302322_907302329 1 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302329 1:53496119-53496141 GTCTTGAGACCCAGAAGTTGGGG No data
907302322_907302327 -1 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302327 1:53496117-53496139 GGGTCTTGAGACCCAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907302322 Original CRISPR CCAGAGTCTTTCAGGCATCA AGG (reversed) Intergenic
No off target data available for this crispr