ID: 907302335

View in Genome Browser
Species Human (GRCh38)
Location 1:53496137-53496159
Sequence TGGGGCCTTCTCCCAGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907302326_907302335 11 Left 907302326 1:53496103-53496125 CCTGAAAGACTCTGGGGTCTTGA No data
Right 907302335 1:53496137-53496159 TGGGGCCTTCTCCCAGGATGGGG No data
907302322_907302335 19 Left 907302322 1:53496095-53496117 CCTTGATGCCTGAAAGACTCTGG No data
Right 907302335 1:53496137-53496159 TGGGGCCTTCTCCCAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907302335 Original CRISPR TGGGGCCTTCTCCCAGGATG GGG Intergenic
No off target data available for this crispr