ID: 907303093

View in Genome Browser
Species Human (GRCh38)
Location 1:53500411-53500433
Sequence TGTTCTCTAGAGCACTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907303093_907303103 25 Left 907303093 1:53500411-53500433 CCACACAAGTGCTCTAGAGAACA No data
Right 907303103 1:53500459-53500481 GGTGGCCGAGCCTCCAGCGCCGG No data
907303093_907303096 4 Left 907303093 1:53500411-53500433 CCACACAAGTGCTCTAGAGAACA No data
Right 907303096 1:53500438-53500460 CGGAGCCCCAGAGAATACCCTGG No data
907303093_907303097 7 Left 907303093 1:53500411-53500433 CCACACAAGTGCTCTAGAGAACA No data
Right 907303097 1:53500441-53500463 AGCCCCAGAGAATACCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907303093 Original CRISPR TGTTCTCTAGAGCACTTGTG TGG (reversed) Intergenic
No off target data available for this crispr