ID: 907305302

View in Genome Browser
Species Human (GRCh38)
Location 1:53509794-53509816
Sequence GTCCCTAAGTGGGAATTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907305287_907305302 12 Left 907305287 1:53509759-53509781 CCCCCACTAGGTCACTGTCTCCT 0: 1
1: 1
2: 4
3: 19
4: 273
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305290_907305302 9 Left 907305290 1:53509762-53509784 CCACTAGGTCACTGTCTCCTCGT 0: 1
1: 0
2: 2
3: 25
4: 144
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305294_907305302 -8 Left 907305294 1:53509779-53509801 CCTCGTTCCTCTGGGGTCCCTAA 0: 1
1: 0
2: 1
3: 10
4: 133
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305288_907305302 11 Left 907305288 1:53509760-53509782 CCCCACTAGGTCACTGTCTCCTC 0: 1
1: 0
2: 3
3: 29
4: 310
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305285_907305302 19 Left 907305285 1:53509752-53509774 CCTGCCTCCCCCACTAGGTCACT 0: 1
1: 0
2: 2
3: 18
4: 226
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305286_907305302 15 Left 907305286 1:53509756-53509778 CCTCCCCCACTAGGTCACTGTCT 0: 1
1: 0
2: 1
3: 16
4: 192
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115
907305289_907305302 10 Left 907305289 1:53509761-53509783 CCCACTAGGTCACTGTCTCCTCG 0: 1
1: 0
2: 0
3: 13
4: 126
Right 907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG 0: 1
1: 0
2: 2
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907305302 Original CRISPR GTCCCTAAGTGGGAATTGGG GGG Intronic
900550528 1:3252285-3252307 GTCCCTGTGCGGGCATTGGGGGG + Intronic
903390293 1:22959155-22959177 GTCCCTGAATGGGAAATGGCTGG - Intronic
907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG + Intronic
911063226 1:93765131-93765153 GTCCTTAATTAGGAGTTGGGAGG - Intronic
913205983 1:116539266-116539288 GTCACTGAGTAGGAGTTGGGAGG + Intronic
913971804 1:143422339-143422361 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
914066183 1:144247952-144247974 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
914112970 1:144718402-144718424 GGCCCTCAGTGGGGACTGGGAGG + Intergenic
917799457 1:178557457-178557479 GTCCCGAAGTAGGAGTAGGGAGG + Intergenic
917822309 1:178776411-178776433 TTCGCTAAGTGGGTATTGCGAGG - Intronic
923042194 1:230327348-230327370 GTCCCTCAGTGAGAGTTGTGGGG - Intronic
1065940796 10:30562478-30562500 TTCCCTCAGTGGCAGTTGGGAGG - Intergenic
1067076752 10:43191891-43191913 GTCCCTCGGTGGGGTTTGGGTGG + Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1071301771 10:84261463-84261485 CTCCATGAGTGGGAATTGGGGGG - Intergenic
1071580171 10:86762017-86762039 TTCCAACAGTGGGAATTGGGTGG + Intronic
1072117984 10:92382025-92382047 GCACCTAAGTGGGTGTTGGGGGG + Intergenic
1073889478 10:108082574-108082596 GTTCCTAAGTGGGAACTTGATGG + Intergenic
1075169717 10:120102032-120102054 GTCCATAAGTGGGAGTTGGGAGG + Intergenic
1076097075 10:127740349-127740371 ATCCCTAAGAAGGAACTGGGTGG - Exonic
1077444592 11:2585070-2585092 GGCCCGAGGTGGGACTTGGGGGG + Intronic
1077601227 11:3576309-3576331 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1077614422 11:3664838-3664860 GTCCGTGTGTGGGAATGGGGTGG + Intergenic
1080110335 11:28559643-28559665 GTCCCTAAATGAAAATGGGGTGG - Intergenic
1084257143 11:67950883-67950905 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1084270976 11:68029012-68029034 GTTCAAAAGTGGGACTTGGGAGG - Exonic
1084815634 11:71644385-71644407 GTGCATAAGTGGGAAATGGTGGG + Intergenic
1085951343 11:81335678-81335700 GTCCCCAAGAGGGAAATGAGAGG + Intergenic
1086766938 11:90707122-90707144 GTCCTGAAGTGGTATTTGGGTGG + Intergenic
1088234929 11:107713034-107713056 GACCCTAATTGGGAATTCAGAGG - Intronic
1092427376 12:8385669-8385691 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1092843137 12:12562132-12562154 TTCCCTCTGAGGGAATTGGGAGG - Exonic
1097338325 12:58409452-58409474 GGCACTAAGGGGGAAGTGGGTGG + Intergenic
1098011935 12:66062232-66062254 GTGCCGAAGAGGGAGTTGGGAGG + Intergenic
1098361494 12:69658680-69658702 GACACTGAGTGGGAATTGGATGG + Intronic
1102747860 12:115265814-115265836 GTCTCAAAGTGGGAAATTGGGGG - Intergenic
1109869949 13:68321468-68321490 GTCCCTAAGGGGGCTTTGGCAGG + Intergenic
1112625582 13:101099869-101099891 GTCCCTGAGTGGTCATTTGGAGG + Intronic
1112691514 13:101901297-101901319 GTCACTACTTGGGAAGTGGGAGG - Intronic
1117901133 14:60534683-60534705 ATCCCTTAGTGGGAGTTGGGAGG - Intergenic
1122076553 14:99238611-99238633 GCCCCTAAGTGGGCATTTGCAGG + Intronic
1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG + Intronic
1123146807 14:106141241-106141263 GTCCCTGAGTGGGAGCAGGGAGG - Intergenic
1124969203 15:34468306-34468328 CTCCCAAAGTGGCAATTGGCTGG - Intergenic
1125889124 15:43252653-43252675 GTCCCTTGGTGGGAACTGTGTGG + Intronic
1127321045 15:57846853-57846875 GTCCCACAGTGGGCATTGGGTGG + Intergenic
1135152776 16:20024059-20024081 GTCCCTAAAAAGGAATTTGGTGG - Intergenic
1136692259 16:32040307-32040329 GTCCCTGAGTGGGAGCAGGGAGG + Intergenic
1136877100 16:33870518-33870540 GTCCCTGAGTGGGAGCAGGGAGG - Intergenic
1137648085 16:50093435-50093457 GTCCCCAGGTGGGAGGTGGGAGG - Intronic
1140106830 16:71968271-71968293 GTACCTAAGTGGGAAGGAGGTGG - Intronic
1203095012 16_KI270728v1_random:1245224-1245246 GTCCCTGAGTGGGAGCAGGGAGG + Intergenic
1145212043 17:21021008-21021030 GTACCTAGGTGGGAAGTGGCAGG - Intronic
1146935561 17:36810681-36810703 TTCCCCAGGTGGGAAGTGGGAGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1160820669 19:1056236-1056258 GTCTCAAGGTGGGAACTGGGGGG + Exonic
1161809778 19:6465041-6465063 GCTCCTAAGTAGGACTTGGGGGG + Intronic
1165948465 19:39459115-39459137 GTCCCTAAGCGGGAAGGGGCGGG + Intronic
1166292043 19:41869573-41869595 GGCCCTCAGTGGGACTTGGCTGG + Intronic
1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG + Intronic
925264908 2:2560323-2560345 GCCCCGAAGTGGCAATGGGGAGG - Intergenic
931513614 2:63027058-63027080 GTCCTTAAGTGTCAAATGGGTGG + Intronic
931741333 2:65248098-65248120 GGCTCTAATTAGGAATTGGGCGG + Intronic
934176494 2:89583271-89583293 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
934286804 2:91657632-91657654 GGCCCTCAGTGGGGACTGGGAGG - Intergenic
938201344 2:129375231-129375253 GTCCCTCAGTGGCACTTGGCTGG - Intergenic
939591360 2:144067482-144067504 GTCCCTAAGTGTGCAGTGAGTGG - Intronic
943683408 2:190791737-190791759 CTGCCTAAGTGTGAAGTGGGCGG - Intergenic
948621950 2:239241000-239241022 TTCCCCAAGTGTGAAGTGGGGGG - Intronic
948754032 2:240148923-240148945 GTCCCTGGGTGGGAGTGGGGAGG + Intergenic
1170398017 20:15948713-15948735 ATTCCTAAGTGGCAATTGGAAGG + Intronic
1170651961 20:18251172-18251194 GTCACTGAGTGGGATGTGGGGGG + Intergenic
1179125902 21:38590309-38590331 TTCAGTAAGTGGGAATGGGGAGG + Intronic
949633226 3:5952405-5952427 GTCCTTAAGGGTGAATTAGGTGG - Intergenic
950750415 3:15123837-15123859 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
950809895 3:15641224-15641246 TTCCCCAACTGGGAATTAGGAGG - Intronic
950918272 3:16667204-16667226 GTCCCGAAGTGGGGATGAGGAGG + Intronic
954689746 3:52389389-52389411 GTGGCTTAGTGGGAGTTGGGAGG + Intronic
956017262 3:64896651-64896673 GTCCCTTGCTGGGAATAGGGAGG + Intergenic
956246073 3:67185209-67185231 GTCCCTAATTGATAATTTGGAGG + Intergenic
957072082 3:75575363-75575385 GTGCATAAGTGGGAAATGGTGGG - Intergenic
961282058 3:125771722-125771744 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
962350356 3:134651578-134651600 CTCCCTAGGAGGGAGTTGGGTGG + Intronic
967121046 3:186383283-186383305 GTCTCTCAGTGGGAACTGGCAGG - Intergenic
967761025 3:193226498-193226520 ATCCATGAGTGGAAATTGGGTGG + Intergenic
968241674 3:197094171-197094193 GTCACTTAGTGGGACTTAGGTGG - Intronic
969015674 4:4102685-4102707 GTGCATAAGTGGGAAATGGTGGG - Intergenic
969738290 4:9005677-9005699 GTGCGTAAGTGGGAAATGGTGGG + Intergenic
973047566 4:45553535-45553557 GTCCCTCAGTGGGACTTATGTGG - Intergenic
978987010 4:115025148-115025170 GTCCCTAAGGGAGATTTGTGGGG - Intronic
982582449 4:157196080-157196102 GTCCCAAGGTGGAAAATGGGAGG - Intergenic
984279275 4:177649228-177649250 GTAACTGAGTGGGAATGGGGGGG - Intergenic
985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG + Intergenic
986338327 5:6770650-6770672 GTCCCTTTGTGAGAAGTGGGAGG - Intergenic
987001897 5:13668251-13668273 GCCCCAAAGTGGGAATTGGGTGG - Intergenic
989452590 5:41604446-41604468 GTCTCTCAGTGGGAGTTGAGAGG - Intergenic
990449845 5:55924157-55924179 GGCTCTAAGCGGGAAGTGGGGGG + Intergenic
994238145 5:97389951-97389973 GTCCCTAAATTGGAATTTGTAGG + Intergenic
997195027 5:131973579-131973601 GTGCCTGAGTGGGACTTGGTTGG - Intronic
1002357235 5:178640864-178640886 GTCCTGAAGTGGGATATGGGCGG + Intergenic
1002703876 5:181147591-181147613 GTACCTATGTGGGCAGTGGGAGG + Intergenic
1004443720 6:15678110-15678132 GACCCCAAGTGAGAATTGGTTGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006436502 6:34028424-34028446 GTCCCTGGGTGGGAACTGGCGGG - Intronic
1007431231 6:41778628-41778650 GGCCTTAGGTGGGAGTTGGGGGG - Intronic
1021773170 7:24025393-24025415 GCACCTAGGTGGGAGTTGGGAGG + Intergenic
1023607877 7:41946266-41946288 AGCTCTAAGTGGGAATTGGGTGG - Intergenic
1026543739 7:71303466-71303488 ATCCCTAAGTTTGAATTGGTGGG + Intronic
1029074340 7:97924318-97924340 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1033442173 7:141390017-141390039 GTCCCTTAGTGGTAATTGCTTGG - Intronic
1036829363 8:12010220-12010242 GTGCATAAGTGGGAAATGGTGGG - Intergenic
1036890920 8:12596542-12596564 GTGCGTAAGTGGGAAATGGTAGG - Intergenic
1036898465 8:12654458-12654480 GTGCGTAAGTGGGAAATGGTGGG - Intergenic
1037643742 8:20771711-20771733 GTCCCTAGGAGAGAATCGGGTGG + Intergenic
1041255306 8:55975157-55975179 GTCCCTGAGTGGGCATTGCTTGG + Intronic
1059634900 9:116160863-116160885 ATCTGTAAGTGGGAATTAGGAGG + Intronic
1061288117 9:129635736-129635758 CTCCCCATGTGGGAATAGGGTGG + Exonic
1187192421 X:17047681-17047703 GGGCTTAAGTGGGAATTTGGGGG + Intronic
1189239060 X:39511661-39511683 TTCCCTAAAGGGGAACTGGGGGG + Intergenic
1189433824 X:40973385-40973407 GGCACTAAGTGGGGATGGGGTGG + Intergenic
1194582117 X:95687134-95687156 GTACCTTAGTGGGAATTACGTGG - Intergenic
1199995670 X:153024234-153024256 CTCCCTCTGTGGGAAGTGGGGGG - Intergenic
1201160163 Y:11159798-11159820 GACCCTAGCTGGGACTTGGGAGG - Intergenic