ID: 907305452

View in Genome Browser
Species Human (GRCh38)
Location 1:53510457-53510479
Sequence TCCAGGGCTCCTCGTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907305452_907305459 30 Left 907305452 1:53510457-53510479 CCACCTGGACGAGGAGCCCTGGA 0: 1
1: 0
2: 0
3: 15
4: 214
Right 907305459 1:53510510-53510532 CTGAGCCCCTGACTTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907305452 Original CRISPR TCCAGGGCTCCTCGTCCAGG TGG (reversed) Intronic
901641713 1:10695945-10695967 CCCAGCGCTCCTCTTTCAGGAGG + Intronic
901697737 1:11021679-11021701 TCCTGGGCTCAGCCTCCAGGGGG + Intronic
902413792 1:16227174-16227196 TCCTGGGCTGCTCTCCCAGGAGG + Intergenic
903422890 1:23231446-23231468 TCCAGGGCTCCTCTTGAACGTGG + Intergenic
904417732 1:30373394-30373416 CCGAGGGCTGCTCTTCCAGGGGG - Intergenic
904587410 1:31587944-31587966 TGCAGGGCTCCCCCTTCAGGCGG - Intergenic
907305452 1:53510457-53510479 TCCAGGGCTCCTCGTCCAGGTGG - Intronic
909413394 1:75379064-75379086 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
915402493 1:155633845-155633867 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
915612849 1:157008657-157008679 CCCAGGGCTCCTATTCCAGGAGG + Intronic
916009603 1:160692753-160692775 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
918824767 1:189309973-189309995 TCCAGGGGTCCTCAACCCGGGGG - Intergenic
920272170 1:204773965-204773987 TTCAGGGCTCCTCTTTCAGCAGG + Intergenic
920367334 1:205455148-205455170 GCCAGAGCTCCTCCTCCAGGTGG + Intronic
921161006 1:212472125-212472147 TCCAGGGCTCAGGGCCCAGGTGG + Intergenic
921923078 1:220690269-220690291 TCCCGGGCCCCACGGCCAGGGGG + Exonic
922536732 1:226386494-226386516 ACCAGGGCTCCTCCTCCAGTTGG - Intronic
923727920 1:236523594-236523616 TCCAGGCCTCCAGGTCTAGGAGG - Exonic
1062804318 10:405819-405841 TCCAGGGCTCCTCACACAGCCGG + Intronic
1063433169 10:6008655-6008677 TCCTGGGTTTCTGGTCCAGGAGG + Intergenic
1063531046 10:6831647-6831669 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1064070159 10:12221985-12222007 TCCAGGGTTTCTGGTCCAGCAGG + Intronic
1066616692 10:37301947-37301969 TTAAGGGCTCCTCGCTCAGGTGG + Intronic
1069387355 10:67896217-67896239 TCCTGGGCTCCTTGAACAGGAGG + Intronic
1069923543 10:71832413-71832435 TCCATGGCCTCTGGTCCAGGTGG - Intronic
1071490524 10:86133461-86133483 GCCAGGGCTGCTCCTGCAGGTGG - Intronic
1071507712 10:86242672-86242694 TCCAGGCCACCTCGTCCAAAAGG + Intronic
1071604177 10:86973223-86973245 TCCAGGGCTCCTAGTGTCGGGGG - Intronic
1072898920 10:99390481-99390503 TCCATGGCTCCTCCCCCAAGAGG - Intronic
1072947888 10:99826926-99826948 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1076266254 10:129111854-129111876 AGCCTGGCTCCTCGTCCAGGTGG - Intergenic
1076767069 10:132642010-132642032 TTCAGGGCTCATGGTCCAGTGGG + Intronic
1077266364 11:1652827-1652849 TCCAGAGCTCCCTTTCCAGGAGG + Intergenic
1077286374 11:1767792-1767814 TTCAGGGCTCCTGGGCCAGTGGG + Intergenic
1077326449 11:1966011-1966033 TCCTGTGCTCCCGGTCCAGGCGG - Intronic
1077590558 11:3487753-3487775 TTCAGGGCTTCTCAACCAGGGGG + Intergenic
1080842992 11:36002048-36002070 GCTGGGGCTCCTCGTCTAGGGGG + Intronic
1081631351 11:44692251-44692273 TCCTGGGCTCCTCCTGCAGACGG + Intergenic
1084511997 11:69611875-69611897 GCGAGGGCTCCCCGGCCAGGTGG - Intergenic
1084779213 11:71397576-71397598 TCCAGGGACCCTGGGCCAGGTGG + Intergenic
1085065728 11:73494000-73494022 TTCAGAGCTCATAGTCCAGGAGG - Intronic
1087723936 11:101697041-101697063 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
1090306142 11:125692967-125692989 CCCAGGACTCATCGCCCAGGAGG + Intergenic
1090635481 11:128688194-128688216 TCTAGGGCTCCTCATCCCTGAGG - Intronic
1202809430 11_KI270721v1_random:21190-21212 TCCTGTGCTCCCGGTCCAGGCGG - Intergenic
1091597178 12:1885982-1886004 TAAAGGGATCCTCGTCCAGGCGG - Exonic
1091602365 12:1925568-1925590 TCCAGGTCTCCTTCCCCAGGTGG - Intergenic
1091602383 12:1925618-1925640 TCCAGGCCTCCTTCCCCAGGTGG - Intergenic
1092927481 12:13284752-13284774 ACCATCGCTCCTCCTCCAGGAGG - Intergenic
1096670521 12:53195814-53195836 TCCAGGGCTCCTCCAGCTGGTGG - Intronic
1096766718 12:53897021-53897043 TCCAGGGCTATTTGTCAAGGAGG - Intergenic
1097331245 12:58334915-58334937 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1100721043 12:97358452-97358474 TCCTGGGTTCCTCTTCCAGGAGG - Intergenic
1103704704 12:122865174-122865196 TCCAGGGCCCCTGGCACAGGTGG - Intergenic
1104000257 12:124855674-124855696 TCCAGGCCTTCTGCTCCAGGAGG - Intronic
1104301872 12:127571718-127571740 CCCAGGGCTCCTCTTCCAAATGG + Intergenic
1104859069 12:131915403-131915425 GGCAGGTCCCCTCGTCCAGGTGG + Exonic
1105892409 13:24690935-24690957 TCCAGGGGTCCTCAGCCAGGAGG - Intronic
1107402839 13:40086151-40086173 CCCAGGGCTCCTGGTGCAGTAGG - Intergenic
1107688524 13:42928406-42928428 TCCAGGGTTCTTAGTCCAGTTGG - Intronic
1113091491 13:106621271-106621293 TCCAGGGCTGCTCTTCTAGCTGG + Intergenic
1113932445 13:113975497-113975519 CCCGGGGCTCCTCAGCCAGGGGG + Intergenic
1115373963 14:32652366-32652388 GCCTGGGCTCCTAGGCCAGGTGG - Intronic
1117828423 14:59727053-59727075 TCCAGGGCTCCGTCTCCAGGGGG + Exonic
1118773974 14:68961987-68962009 GCCAGGGCTTGTGGTCCAGGGGG - Intronic
1121087798 14:91159945-91159967 TGCTGGGCTCCTTGGCCAGGAGG - Intronic
1122150302 14:99722006-99722028 TCAAGGTCTCCTCTTCCAGCAGG - Exonic
1122174839 14:99909117-99909139 TCAAGGGCTCATTGTCCAGTGGG + Intronic
1122318532 14:100839724-100839746 TGCAGGGCTCCTGGGACAGGAGG - Intergenic
1123813169 15:23949555-23949577 TCCAACGCTCCTCCTCCTGGAGG - Intergenic
1123892271 15:24793845-24793867 TCCAATGCTCCTCCTCCTGGAGG - Intergenic
1123895857 15:24829320-24829342 TCCAAAGCTCCTCCTCCTGGAGG - Intronic
1124089343 15:26583350-26583372 TGCAGTTCTGCTCGTCCAGGGGG + Exonic
1124394031 15:29285035-29285057 CCCAGGGTTTCTCCTCCAGGTGG + Intronic
1124634451 15:31355994-31356016 TCCAGTGCACCCCTTCCAGGAGG - Intronic
1125258802 15:37798541-37798563 ACCAGGGCTCCTCGTCAAGTAGG - Intergenic
1125733918 15:41910406-41910428 TTCTGGGCTCCTCTCCCAGGGGG - Intronic
1126798054 15:52276341-52276363 TCCAGGGGTCCTCTCCCAGTCGG + Intronic
1129036074 15:72648984-72649006 TCCTTGGCTCCCCTTCCAGGTGG + Intergenic
1129213812 15:74088232-74088254 TCCTTGGCTCCCCTTCCAGGTGG - Intergenic
1129400200 15:75277131-75277153 TCCTTGGCTCCCCTTCCAGGTGG + Intronic
1129629190 15:77238848-77238870 TACATGTCTCCTTGTCCAGGAGG + Intronic
1132762976 16:1519936-1519958 GCCTGGTCTCCTGGTCCAGGGGG + Exonic
1133355927 16:5136838-5136860 TTCAGGGCTTCTCAACCAGGGGG + Intergenic
1134052755 16:11148376-11148398 TCCAGACCTCCTCCACCAGGAGG - Intronic
1136403710 16:30031417-30031439 CCCAGGGCTCCTTGGCCAGCTGG + Intronic
1138111637 16:54328959-54328981 TCCATGTCTCATCCTCCAGGAGG + Intergenic
1138124450 16:54427218-54427240 TCCAAGGCTCCAGCTCCAGGTGG - Intergenic
1138447943 16:57076531-57076553 TCCAGAGCCCCTGGCCCAGGAGG - Intronic
1139206710 16:65035968-65035990 CTCAGGGCTTCTTGTCCAGGTGG + Intronic
1140420253 16:74813378-74813400 TGCAGGGCCCCTCGGGCAGGGGG - Intergenic
1142343418 16:89538481-89538503 CCCAGGGCTCCTCGTCCACCCGG - Intronic
1142364135 16:89640855-89640877 TACCGGTCTCCGCGTCCAGGTGG - Intergenic
1143329092 17:6120792-6120814 TCCAGGTCTCCTTGTGCGGGAGG - Exonic
1145797176 17:27662487-27662509 TCCAGGGCTCCTGGCCCACATGG - Intergenic
1147141284 17:38461908-38461930 TCCAGAGCTCCCTGTCCAGTGGG - Intronic
1148208653 17:45795037-45795059 TCCAGATCTCCTCCTGCAGGGGG - Intronic
1151364994 17:73611482-73611504 CCCAGGGCACCTCTCCCAGGGGG - Intronic
1152011841 17:77723755-77723777 TCCTGGGCACCCCCTCCAGGTGG - Intergenic
1154024825 18:10697246-10697268 TCCAGGGCTCCACTCCCAGCTGG + Intronic
1155248816 18:23936586-23936608 CTCAGGGCTCATTGTCCAGGAGG - Intronic
1156036127 18:32770190-32770212 TGCAGGGCTGCTCGTCCATCGGG - Exonic
1156308916 18:35904937-35904959 GCCTGGCCTCCTCTTCCAGGTGG + Intergenic
1160806263 19:993518-993540 CCCAAGGCGCTTCGTCCAGGAGG + Intronic
1160900381 19:1424894-1424916 TCCAGGCCTCCCCGGCTAGGTGG - Intronic
1161250016 19:3275550-3275572 TCCACTGCTCCCCCTCCAGGCGG - Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1162016201 19:7847834-7847856 TCCACGTGTCCTCCTCCAGGTGG - Exonic
1162477920 19:10911987-10912009 CCCAGGGCTTCTCCTCCCGGAGG + Intronic
1163161706 19:15468813-15468835 TCCAGGGTTCCACCACCAGGAGG - Intronic
1164153888 19:22576902-22576924 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1164371142 19:27645421-27645443 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1165092546 19:33394581-33394603 TCCAGGGGCCCCCGCCCAGGCGG - Intronic
1165490830 19:36121748-36121770 TCCAGGGCTCCAAGGCCGGGAGG + Intronic
1167575902 19:50317264-50317286 TTCCGGGCTCCTAGTCCAGAGGG - Intronic
1167741835 19:51328664-51328686 TCCAGGGATCCTGGGCCTGGGGG - Exonic
925856625 2:8135155-8135177 GCCTGGCCTCCTCCTCCAGGTGG - Intergenic
928928035 2:36598064-36598086 TACAGTTCTCCTGGTCCAGGAGG + Exonic
929646951 2:43637443-43637465 TTGAGGGCGCCCCGTCCAGGGGG + Intronic
929786872 2:44999757-44999779 TCCAGAGCTCCTGGACCATGTGG + Intergenic
930755515 2:54968423-54968445 TCCAGGACTGCCCCTCCAGGAGG - Intronic
931206316 2:60149196-60149218 TCCAGGGCTCTCCCTCAAGGCGG - Intergenic
934054609 2:88241285-88241307 TCCTGGGCTCCTCCTCTGGGCGG - Intergenic
936071418 2:109374163-109374185 TCCAGGGCTTCCTATCCAGGTGG - Intronic
938420323 2:131140781-131140803 TCCAGGTCTCCTGGGCAAGGGGG + Intronic
947073477 2:226317123-226317145 TCCTGGCCTCCTGCTCCAGGGGG + Intergenic
948078951 2:235189823-235189845 CCTAGGGCTGCTGGTCCAGGTGG - Intergenic
948526599 2:238574619-238574641 TCCCGGGCTCCACTCCCAGGAGG + Intergenic
948837878 2:240635181-240635203 TCCAGGGGTCCCTGCCCAGGAGG + Intergenic
948859608 2:240746486-240746508 GCCAGGGCCCCTTGTCCAGCAGG + Intronic
1169283789 20:4290173-4290195 TCCAGGTCTCCTCCTTCTGGAGG - Intergenic
1169331113 20:4717183-4717205 TCCAGGTAGCCTCGTCCTGGGGG + Intergenic
1171486353 20:25489288-25489310 TGCAGAGCTCCTGGCCCAGGAGG - Exonic
1173410838 20:42808219-42808241 TCCATAGCTGCTAGTCCAGGGGG + Intronic
1174554279 20:51382777-51382799 TCCAGGGCTCCTCGGAGAGTCGG - Intergenic
1175395850 20:58661043-58661065 TCCAGGGCCCCGTGCCCAGGCGG - Intronic
1175928058 20:62480542-62480564 GCCAGGGCTGCTCCTCAAGGGGG - Intergenic
1177171684 21:17662339-17662361 TCCAAGGCCCTTCTTCCAGGGGG - Intergenic
1177248934 21:18567808-18567830 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1178144876 21:29727874-29727896 TCCGGGGCTCCGCTTACAGGCGG - Intronic
1178408733 21:32347034-32347056 CCCAGGGCTCGGCCTCCAGGGGG - Exonic
1180837944 22:18940652-18940674 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1181863218 22:25835305-25835327 TCCTGGGCACCTCCTCCAGCTGG - Exonic
1182426571 22:30276376-30276398 CCCAGGGCACTTCCTCCAGGTGG - Intergenic
1183189407 22:36312177-36312199 ACCAGCACTCCTCGTCCAGCAGG + Exonic
1183680565 22:39326475-39326497 CCCAGGGGTCCTCCTCAAGGGGG + Intergenic
1184090681 22:42291498-42291520 CCCAGGGCTCATAGTCCAGACGG - Intronic
1184332569 22:43835417-43835439 GCCAGCGCTCCTCATCCAGCTGG - Intronic
1184607055 22:45580239-45580261 TCCAGGGCTGCTGCTCCTGGTGG + Intronic
1185197265 22:49479731-49479753 TCCAGGGCCCCCGCTCCAGGAGG + Intronic
949498409 3:4655355-4655377 TCCTGGCCTCCTGGTACAGGAGG + Intronic
950030886 3:9852602-9852624 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
953032392 3:39187177-39187199 TCATGGGCTGCTCTTCCAGGAGG + Exonic
954626718 3:52025880-52025902 CCCAGGGCTCCTGGTCTAGGAGG - Intergenic
954695496 3:52422741-52422763 TCCTGGGCTCTTCCTCTAGGAGG + Exonic
955572893 3:60327025-60327047 TCCAGGTCTCCTCCTCATGGAGG + Intronic
956178886 3:66500186-66500208 TCACAGGCTCCGCGTCCAGGAGG + Exonic
957060588 3:75478267-75478289 TTCAGGGCTTCTCAACCAGGGGG + Intergenic
960028134 3:113031443-113031465 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
961894398 3:130155259-130155281 TTCAGGGCTTCTCAACCAGGGGG + Intergenic
963695998 3:148566577-148566599 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
967026567 3:185569731-185569753 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
967294077 3:187948547-187948569 GCCAGGTCTCCTGATCCAGGAGG + Intergenic
968528309 4:1076182-1076204 TCCCGGGCACCTTGTCCAGGAGG + Intronic
968731724 4:2272257-2272279 GCCAGGGCTCCAGGACCAGGCGG + Intronic
969004487 4:4008338-4008360 TTCAGGGCTTCTCAGCCAGGGGG + Intergenic
969098450 4:4751618-4751640 TCCAGACCTCCCCTTCCAGGTGG + Intergenic
969465658 4:7354763-7354785 CCCAGGGCTCCTCGTGCTGTGGG - Intronic
969748381 4:9091810-9091832 TTCAGGGCTTCTCAGCCAGGGGG - Intergenic
969809412 4:9636369-9636391 TTCAGGGCTTCTCAGCCAGGGGG - Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
978295911 4:107205068-107205090 TCCAGAGCTCCTGTTACAGGAGG - Intronic
979205627 4:118033830-118033852 CCCAGGGCCCCTCGTCCGGGTGG - Intronic
981533377 4:145774590-145774612 TCCACTGCTCCTTGTCCACGTGG + Exonic
982876789 4:160660597-160660619 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
984505348 4:180610620-180610642 TCCAGGACTCATAGTCCAGAAGG + Intergenic
986187299 5:5456667-5456689 TCCAGGGCTCCTTGGATAGGCGG - Intronic
988380702 5:30494115-30494137 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
999136366 5:149322599-149322621 GCTCGGGCTCCTCGTCCTGGTGG - Exonic
999952400 5:156664885-156664907 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1000201776 5:159018022-159018044 GCCATGGCTCCTTGCCCAGGAGG - Intronic
1003577893 6:7314448-7314470 TTCAGGTCTCCTTGTCCTGGGGG + Intronic
1006196201 6:32243971-32243993 TCCAAGGCTCCCAGTCTAGGTGG + Intergenic
1008868810 6:56247583-56247605 TCCCGGGCTCCGCCTCCAGGGGG - Exonic
1009192137 6:60641935-60641957 TCTAGGGCTCCTCACCCAGAGGG + Intergenic
1010592186 6:77724374-77724396 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1019131854 6:169882757-169882779 TCCCGGGCTCCTGAGCCAGGAGG + Intergenic
1019656082 7:2196832-2196854 TCCACGGCTCCTACTCCATGAGG + Intronic
1019892837 7:3960395-3960417 TCCAGGGCTTCAGGTCCTGGGGG - Intronic
1019976860 7:4589897-4589919 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1019977795 7:4598400-4598422 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1020324623 7:6964837-6964859 TTCAGGGCTTCTCAGCCAGGGGG + Intergenic
1022199609 7:28103745-28103767 ACCAGTGGTCCTGGTCCAGGTGG - Intronic
1023395240 7:39745755-39745777 TCCAGGGCCCCTGGTCAACGAGG - Intergenic
1025250335 7:57347500-57347522 TTCAGGACTCCTCCACCAGGAGG - Intergenic
1026114956 7:67488334-67488356 TCCTGGGCTCCATCTCCAGGAGG + Intergenic
1026499807 7:70934905-70934927 TCCACACCTCCTCCTCCAGGAGG + Intergenic
1027669237 7:81075400-81075422 TCTCTGGCTCCTCTTCCAGGTGG + Intergenic
1029967144 7:104751790-104751812 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1032757567 7:134905648-134905670 TCCAGCCCTGCTCCTCCAGGAGG - Intronic
1034533558 7:151712613-151712635 TCCTGGGCTGCAGGTCCAGGAGG + Intronic
1034919791 7:155070599-155070621 CCCAGGGCTCCTCGCCTTGGTGG - Exonic
1035203165 7:157279442-157279464 CCCAGGGCTCGGAGTCCAGGAGG + Intergenic
1035774163 8:2174416-2174438 CCCTGGGCCCCTCTTCCAGGAGG - Intergenic
1036292403 8:7505345-7505367 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1037993275 8:23335756-23335778 TCCAGGGCTGCTGGACCAGCAGG - Intronic
1043414047 8:80030323-80030345 TCCAGAGCTCTGCGTCCGGGGGG - Intronic
1047173370 8:122516513-122516535 TCCAGAGGTTCTCGACCAGGAGG - Intergenic
1048947368 8:139461961-139461983 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1049531106 8:143156031-143156053 CCCAGGGCCCCGTGTCCAGGTGG - Intergenic
1050925324 9:11256773-11256795 TCCAGGGCTGCTGGTCCTGTAGG + Intergenic
1051481752 9:17569274-17569296 TCCAGAGTTGCTCATCCAGGAGG + Intergenic
1053475042 9:38376571-38376593 CCCGGGGCCCCTCGTCAAGGAGG + Intergenic
1059424057 9:114209824-114209846 TCAAGTGCACCTCCTCCAGGAGG - Intronic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1062104011 9:134742868-134742890 CCCTGGGCTCCTCGGGCAGGTGG + Intronic
1062442229 9:136575961-136575983 GCCTCGGCTCCTCTTCCAGGTGG - Intergenic
1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG + Intergenic
1062574380 9:137199672-137199694 TCCGGGGCTCCTCCTCCTGAGGG - Exonic
1185734420 X:2486086-2486108 TCCAGGCTGCCTCGTCCATGGGG + Intronic
1188777516 X:34239147-34239169 TGCAGGGCTCTTCCTCAAGGGGG - Intergenic
1194147417 X:90280783-90280805 TCCAAGTCTCCTAGTCCTGGAGG - Intergenic
1196778061 X:119359209-119359231 TCCAGGGCAGCTCATCCAGCTGG + Intergenic
1198550094 X:137736208-137736230 TCCAGGGCTGATCATCCAGGAGG - Intergenic
1199215246 X:145254511-145254533 TCCAGGTCCCTTCTTCCAGGCGG - Intronic
1199270525 X:145877658-145877680 TCCAGGGCCCCTCTTCGATGAGG - Intergenic
1200493819 Y:3857545-3857567 TCCAAGTCTCCTAGTCCTGGAGG - Intergenic
1201557310 Y:15276424-15276446 TACATGGCTTCTCCTCCAGGAGG + Intergenic
1202377164 Y:24247684-24247706 TCTGGGGCTCCTCGTTCAGTGGG + Intergenic
1202493616 Y:25422437-25422459 TCTGGGGCTCCTCGTTCAGTGGG - Intergenic