ID: 907305540

View in Genome Browser
Species Human (GRCh38)
Location 1:53511002-53511024
Sequence CCTGGACCACAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 269}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907305531_907305540 -3 Left 907305531 1:53510982-53511004 CCCAGCCCGAGGGCCCACTACCT No data
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305535_907305540 -9 Left 907305535 1:53510988-53511010 CCGAGGGCCCACTACCTGGACCA 0: 1
1: 1
2: 0
3: 11
4: 150
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305525_907305540 9 Left 907305525 1:53510970-53510992 CCCTGAGCCCAGCCCAGCCCGAG 0: 1
1: 1
2: 5
3: 68
4: 470
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305526_907305540 8 Left 907305526 1:53510971-53510993 CCTGAGCCCAGCCCAGCCCGAGG 0: 1
1: 0
2: 11
3: 98
4: 633
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305530_907305540 1 Left 907305530 1:53510978-53511000 CCAGCCCAGCCCGAGGGCCCACT 0: 1
1: 0
2: 1
3: 30
4: 318
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305529_907305540 2 Left 907305529 1:53510977-53510999 CCCAGCCCAGCCCGAGGGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 500
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305532_907305540 -4 Left 907305532 1:53510983-53511005 CCAGCCCGAGGGCCCACTACCTG No data
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269
907305534_907305540 -8 Left 907305534 1:53510987-53511009 CCCGAGGGCCCACTACCTGGACC 0: 1
1: 1
2: 0
3: 9
4: 141
Right 907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907305540 Original CRISPR CCTGGACCACAGGATGCTGC AGG Intronic
900161490 1:1226233-1226255 CCTGCACCACGAGATGCTCCAGG - Intronic
900396409 1:2454929-2454951 CCTGGACAACAGGTTTCTGGGGG - Intronic
900727241 1:4224794-4224816 CCCTGACAACACGATGCTGCTGG + Intergenic
900985856 1:6072541-6072563 CCCGGCCCACACCATGCTGCTGG - Intronic
901257568 1:7843774-7843796 CCTCGCCCACAGGGTCCTGCAGG + Exonic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
901959124 1:12810520-12810542 CCTGGACCCCAGGCTGCTACAGG + Intergenic
902512019 1:16971804-16971826 CCGGGGCCACGGGATGCTCCTGG + Intronic
903328143 1:22583066-22583088 CCAGGGCCACAGGCAGCTGCTGG + Intronic
903364653 1:22798553-22798575 CCTAGACCAGAGGCTGCTGTGGG + Intronic
904334330 1:29787222-29787244 GCTGGGCCACAGGATGATGGTGG - Intergenic
904336981 1:29804304-29804326 CCAGGACAACAGGATGCTCTGGG - Intergenic
904408640 1:30311567-30311589 CCTGGCCCCCCGCATGCTGCAGG - Intergenic
905004538 1:34699140-34699162 TCTAGAGCACAGGAAGCTGCAGG + Intergenic
905249481 1:36638758-36638780 CCTGGAGGAGAGGATGCTGAAGG - Intergenic
905897679 1:41559126-41559148 CTTGGACCAAAGGAGGCAGCGGG - Intronic
905909411 1:41643601-41643623 CCTGGACCAAAGGTTGCCCCAGG + Intronic
905966787 1:42104999-42105021 CCTGAACCTTAGGATGCTGCTGG - Intergenic
906952854 1:50348747-50348769 CCTGGACCAAGTGATGGTGCAGG + Intergenic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
907823597 1:57994230-57994252 GCAGGACCACAGGATTCTGCAGG - Intronic
907859360 1:58336234-58336256 CCTAGACCCCAGCATGCTGAGGG - Intronic
908778178 1:67662068-67662090 CCTGGAACACAAGATGTTGAAGG - Intergenic
910194512 1:84626159-84626181 CCTGGATCACAGGCTACTGATGG - Intergenic
910238828 1:85064236-85064258 CCTGAACCAGAGGAGGCTGTGGG + Intronic
911163987 1:94709033-94709055 CCTGGACCTGAGGACGGTGCTGG - Intergenic
915558368 1:156672842-156672864 CCTGGACCAGAGGAGCCTGGGGG - Exonic
916602301 1:166304856-166304878 CCTGGCTCACAGGATTCTGTAGG + Intergenic
920839779 1:209544890-209544912 CCTGGGCCACAGGATCCCTCTGG + Intergenic
921301271 1:213753630-213753652 CCAGGACCACCTGATGCTGCAGG + Intergenic
921585170 1:216937732-216937754 CCTGAAACCCAGGATGTTGCAGG + Intronic
922215304 1:223515468-223515490 CCTGGCCCACAGGTCCCTGCTGG - Intergenic
922606005 1:226890376-226890398 CCTGCACCGCAGCATGCCGCTGG - Intronic
922627009 1:227058332-227058354 ACAGGACCACAGGAAGCAGCAGG + Intronic
923052370 1:230397826-230397848 GCTTAACCACAGGATGCTGCCGG + Intronic
1063299489 10:4838919-4838941 CCAGGAACACAGGATGCGGAAGG + Intronic
1064806030 10:19134207-19134229 CCTGGGGCACAGCATGGTGCTGG - Intronic
1067042427 10:42962169-42962191 CCTGGAGCACAGGAGGCCGGGGG - Intergenic
1067523289 10:47023643-47023665 CCTGGACTGCAGGCTGCTCCTGG - Intergenic
1069914897 10:71781442-71781464 CCTGGAGCACAGGAGGATGCCGG + Intronic
1070269424 10:74938402-74938424 CCTGGTTCACATGATACTGCTGG - Intronic
1070500477 10:77067859-77067881 CCTAGACCTAAGGATGCTGATGG + Intronic
1073707524 10:106001848-106001870 CATGGGCCACAGAATGCTGGTGG + Intergenic
1074031828 10:109696828-109696850 CCTGGACCCAAAGGTGCTGCAGG + Intergenic
1074392313 10:113068635-113068657 CCTGGACCTCAGGCTGTTTCAGG + Intronic
1074417229 10:113277553-113277575 CGTGAAACACAGGATGCTGTGGG - Intergenic
1075836005 10:125453369-125453391 CCAGGACCCCAGGAGGCTGTGGG - Intergenic
1076299486 10:129414271-129414293 CCTGGAACACAGGCTGGTTCAGG + Intergenic
1076601671 10:131660758-131660780 CCTGGTCCTGAGGTTGCTGCTGG - Intergenic
1076703036 10:132284116-132284138 CGTGGACCACAGGAGGATGGTGG + Intronic
1077177189 11:1196273-1196295 CCAGGCCCACAGGTGGCTGCGGG + Intronic
1077385364 11:2267209-2267231 CCAGGACCACAGGGGGCTGTTGG - Intergenic
1078618102 11:12883343-12883365 CCTGGACCCCAAGGTGCTGTGGG + Intronic
1078672123 11:13374928-13374950 CCTGGAGCACAGGCCTCTGCAGG - Intronic
1079064306 11:17276458-17276480 CCTGCTCCACAGGATTCTCCGGG + Intronic
1080114581 11:28607250-28607272 CCTGAACCACAGGATCATGGTGG - Intergenic
1083475107 11:62910290-62910312 CCGGGCCCCCAGGCTGCTGCAGG - Exonic
1084773285 11:71357896-71357918 AGTGGACTGCAGGATGCTGCAGG + Intergenic
1084936760 11:72590765-72590787 CCTGGACCGCCGGACGCTCCAGG - Intronic
1086847925 11:91774461-91774483 TCAGCACCACAGGATGCTGATGG + Intergenic
1086893380 11:92284517-92284539 CCTGGAGCACAGGACTCAGCAGG + Intergenic
1088560628 11:111112227-111112249 ACTGGAGCACAGAATGCTGAGGG + Intergenic
1089082636 11:115789707-115789729 CCTGGACCCCAGGATGGGGAAGG + Intergenic
1089255710 11:117192816-117192838 CCAGGACCGCATGGTGCTGCTGG + Exonic
1089379085 11:118014855-118014877 GCTGGACCTCAGGATGGTGTGGG + Intergenic
1091666285 12:2420704-2420726 CCAGCACCCCAGGCTGCTGCTGG - Intronic
1091753783 12:3038828-3038850 CCCAGAACACAGGGTGCTGCAGG - Intronic
1091808912 12:3378784-3378806 CCTGGCCCACAGGACCCGGCAGG + Intergenic
1092165012 12:6337097-6337119 CCTGGCCCCCAGAATGCTCCAGG + Intronic
1096153195 12:49327436-49327458 CCTGGGCCTCAGGATGTTACTGG + Intronic
1096159840 12:49367363-49367385 GCCGGACTGCAGGATGCTGCCGG - Intronic
1097594421 12:61610711-61610733 CTAGAACCACAGGAAGCTGCTGG + Intergenic
1102507382 12:113392273-113392295 CCTGTACCACAGGAAGCAGGTGG - Intergenic
1102701934 12:114846922-114846944 TGTGGACCAGAGGAAGCTGCTGG + Intergenic
1103209644 12:119156987-119157009 GCTGGGCCCCAGGATGATGCTGG - Exonic
1103607272 12:122096656-122096678 CCTGCCCCACAGCAGGCTGCTGG - Intronic
1103699677 12:122842604-122842626 CCTGGGCCACAGGGTGCCGCGGG + Intronic
1104260431 12:127177199-127177221 CCTAGTCCACATGGTGCTGCTGG + Intergenic
1105587733 13:21760418-21760440 CCTGGCCTTCAGGATCCTGCAGG - Intergenic
1107415967 13:40200413-40200435 CCTAGAGCAGGGGATGCTGCAGG - Intergenic
1110253805 13:73409753-73409775 TCTGGGCCACAGGTTGGTGCTGG + Intergenic
1112780496 13:102895527-102895549 CATGGCCCACAGGATGATGGTGG - Intergenic
1114645665 14:24254765-24254787 CCTGGTCCACAAGATGGGGCCGG + Exonic
1117832735 14:59768966-59768988 CCAGGACCAAAGGATTCTGTAGG + Intronic
1118721855 14:68600074-68600096 CCTGTCCCACGGGATGCAGCAGG + Intronic
1119205101 14:72788239-72788261 ACTGGACCACAGGATGCAGGAGG + Intronic
1119391618 14:74294971-74294993 CCTGGACCTAAGGATGAGGCAGG + Intronic
1121051529 14:90821990-90822012 CCTGGACCACAGACTGGTACTGG - Intergenic
1121981376 14:98457390-98457412 CCTGGACAACCAGATGGTGCCGG - Intergenic
1122212557 14:100182061-100182083 GCTGGAGCAGAGGATGCTGGAGG + Intergenic
1122472830 14:101983507-101983529 CCCTGCCCACAGGAAGCTGCAGG + Exonic
1122803458 14:104244770-104244792 CCAGGGCCACAGCATGCTTCTGG - Intergenic
1125717233 15:41826230-41826252 CCTGGACCCCAGCCGGCTGCTGG + Exonic
1129519153 15:76175219-76175241 TCTGGACCATAGGATGCTAGTGG - Intronic
1130926028 15:88386533-88386555 CCTGGCACAAAGGGTGCTGCTGG - Intergenic
1130961597 15:88663160-88663182 TCTGCACCACAGGCTGCTGACGG - Intergenic
1130964349 15:88686000-88686022 CCTGGATCCCAAGATGCTGGTGG - Intergenic
1131109618 15:89756902-89756924 GCTGGACCTCAGGAGGCTCCAGG + Intergenic
1131146832 15:90019756-90019778 CCATGACCCCAGGAAGCTGCAGG + Intronic
1132227217 15:100151668-100151690 CCTTCTCCACAGGATGGTGCAGG + Intronic
1132350149 15:101134263-101134285 CCTGGACAGCGGGAGGCTGCAGG - Intergenic
1132571740 16:647251-647273 CCTGGGCCACCGGCTGCTGTGGG + Intronic
1132715980 16:1289982-1290004 CCAGAACATCAGGATGCTGCTGG + Intergenic
1132824238 16:1895248-1895270 CCTGAACCAAAGCATGTTGCTGG - Intergenic
1133732787 16:8590545-8590567 CCTGGAGCGCTGGAGGCTGCCGG + Intergenic
1134636845 16:15799171-15799193 CAAGGACCACAGGATGCTTCTGG - Intronic
1134888578 16:17818033-17818055 CCCAGATAACAGGATGCTGCTGG + Intergenic
1136172921 16:28499162-28499184 GCTCGGCCTCAGGATGCTGCTGG + Intergenic
1136186468 16:28591497-28591519 CCTAGACCACAGGAGGCTCTGGG - Intronic
1136188955 16:28604221-28604243 CCTAGACCACAGGAGGCTCTGGG - Intergenic
1136294030 16:29291645-29291667 CCTGGGTCACAGGGTGCTGGAGG + Intergenic
1138395078 16:56697801-56697823 GCTGGGCCACTGGCTGCTGCTGG + Intronic
1138580994 16:57940311-57940333 CCCGGGTCACAGGGTGCTGCTGG - Exonic
1139573015 16:67825079-67825101 CCTGGACCCCTGTATGCAGCTGG - Intronic
1140510236 16:75502321-75502343 GCTGGACCACGGGATGCTGGAGG + Intergenic
1140516002 16:75542387-75542409 GCTGGACCATGGGATGCTGGAGG + Intronic
1140769581 16:78191118-78191140 GCTGGACCACTGGATCCAGCTGG + Intronic
1141912931 16:87072268-87072290 CCTGGACACCAGGATGCCGTCGG + Intergenic
1141935199 16:87233831-87233853 CCTGGACCCCAGGGAGCTTCAGG - Intronic
1142002206 16:87670392-87670414 GCTGGACCACAGGGAGCAGCAGG - Intronic
1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG + Intergenic
1142122431 16:88393516-88393538 CCTGGGCCACAGGACACAGCAGG - Intergenic
1142504924 17:357208-357230 CCTGGATCAGAGGATGGTGCCGG - Intronic
1147218590 17:38915056-38915078 ACTGGGCCACCGGCTGCTGCTGG - Exonic
1147535334 17:41317097-41317119 CCTGGACCAGATGATGTTTCAGG - Intergenic
1147611081 17:41802170-41802192 TCTGGACCACAGGATGGTGGTGG - Exonic
1149667012 17:58371992-58372014 CCTGGACCATAGGATTATTCAGG - Intronic
1150514296 17:65791361-65791383 CCTGGGCCACAAGATCCTGGTGG - Intronic
1151834164 17:76572525-76572547 CCTGGTCCAGTGGATGCTGAGGG - Intronic
1152061295 17:78077639-78077661 CCTGGACCTCTGGATGCATCCGG - Intronic
1152350117 17:79779392-79779414 CCTGGACCCGAGGCTGCTCCTGG + Exonic
1152894285 17:82901681-82901703 CCTGGACCACAGTAGGCAGCCGG - Intronic
1153659003 18:7309886-7309908 CCTGGTCCACAGGAAGCACCAGG + Intergenic
1154045920 18:10904685-10904707 CCTGGATCCCAGGATGGAGCAGG + Intronic
1155153026 18:23136717-23136739 CCCGGAGCACAGGATCCGGCAGG - Intronic
1155982634 18:32196699-32196721 CCTGGCCCTCAGCCTGCTGCAGG - Intronic
1156395051 18:36691737-36691759 CCTGCAGCCCAGGATGCTGAGGG - Intronic
1156502499 18:37568361-37568383 CCAGCACCACAGGATGATGTTGG - Intergenic
1157212164 18:45752858-45752880 CCTGGGCCACAGCATGCCTCAGG + Intergenic
1159010931 18:63058003-63058025 CCTGGACCACAGTAAGGGGCAGG + Intergenic
1159958539 18:74537617-74537639 GCTGGACCACAGGATGCAGAGGG + Intronic
1160353683 18:78207948-78207970 CCAGGACCACAGGAAGATGAGGG - Intergenic
1160572472 18:79827523-79827545 CCAGGAACACAGGCTGCTGGAGG - Intergenic
1161323466 19:3651989-3652011 CATGGACTACAGCCTGCTGCTGG - Exonic
1161676387 19:5652501-5652523 CCTCGGCCACTGGCTGCTGCAGG + Intronic
1161978782 19:7620025-7620047 CATGGACGACATGAAGCTGCTGG - Exonic
1161999035 19:7731566-7731588 ACAGGACCCCAGGATGCAGCTGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162551723 19:11361818-11361840 CCAGGCCCCCAGGATGCTACAGG + Intronic
1163763679 19:19150681-19150703 CCTGGACCAAAGGAATCGGCAGG - Exonic
1165612638 19:37169726-37169748 GCTGGGCCACAGGAAGCAGCTGG - Intronic
1168413283 19:56153374-56153396 CCTGGAGCTCAGGATGGTGCTGG + Intronic
1168700594 19:58437074-58437096 CCTGTACCACAGTGTGATGCTGG - Exonic
925247965 2:2401566-2401588 GCTGATCCACAGGATGCTGTAGG + Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
926121310 2:10242653-10242675 CCTAGACCAGAGGAAGCTCCTGG - Intergenic
926157459 2:10464885-10464907 CCAAGACCCCAGGATGCCGCTGG - Intergenic
927173116 2:20387016-20387038 CTTCCACCACATGATGCTGCAGG + Intergenic
927521911 2:23704035-23704057 CCTGGACCAGAGGCTGCCGTGGG - Intronic
927684493 2:25161251-25161273 CCTGGAGCACAGCCTGCTGGTGG - Exonic
928089016 2:28362930-28362952 CCAGGACCACAGGCTTCCGCAGG - Intergenic
930781185 2:55225725-55225747 CCTGGAGGAGGGGATGCTGCAGG - Intronic
931836087 2:66099371-66099393 CCTAGCCCACAGCATGCTGATGG + Intergenic
932886669 2:75554949-75554971 CCTGGACCTCAAGATGCTCATGG - Intronic
933576224 2:84071400-84071422 TCAGGACCCCAGGAAGCTGCTGG - Intergenic
935582139 2:104765568-104765590 ACTGGAGCATAGGATGCTGTGGG + Intergenic
935794308 2:106626595-106626617 CTGGAACCACAGGATGCTTCAGG + Intergenic
937477924 2:122231402-122231424 TCTGGCCCACAGCCTGCTGCTGG + Intergenic
938379193 2:130827171-130827193 CCTGGAGCAGGGGCTGCTGCGGG - Intergenic
943524504 2:188999485-188999507 CCTGGGCCACCTGGTGCTGCTGG + Exonic
943781223 2:191825948-191825970 CCTGGATCAAAGGATGGTACTGG + Intergenic
944430943 2:199633071-199633093 CCTGGGCTAGAGGATGTTGCTGG + Intergenic
946161431 2:217838342-217838364 CCTGCACCCCAAGCTGCTGCAGG - Intronic
946752320 2:222904912-222904934 CCTGGGACACAGGATCCTGCTGG - Intronic
947550386 2:231041425-231041447 CCTGGCCCTCAGGATGCAGGAGG - Intronic
948763674 2:240208617-240208639 CCTGGCCCAGAGGTTTCTGCAGG + Intergenic
948831723 2:240601573-240601595 CCTTGGCAACAGGATGCTGATGG - Intronic
948879548 2:240849831-240849853 GCTGGACAGCAGGACGCTGCCGG + Intergenic
1168920467 20:1530814-1530836 CCTAGACCAAATGATGCTGGAGG - Intergenic
1168928027 20:1598871-1598893 CCTGGGCCCCAAGGTGCTGCTGG - Intronic
1168946856 20:1768007-1768029 CCTGGGCCTCAGGGTGCTGCTGG - Intergenic
1170384536 20:15801320-15801342 GCTGGAGCAGAGGATGCTGGAGG + Intronic
1170613259 20:17930476-17930498 CCTGGACCCCAAAATGCTACTGG + Intergenic
1171229959 20:23476114-23476136 CCTGGACCCTGGGAGGCTGCAGG + Intergenic
1171302714 20:24077821-24077843 CCTAGGCCATAGGATGCTGCTGG + Intergenic
1171878152 20:30597578-30597600 CCTGGCCCCCAGGCTGCTCCAGG + Intergenic
1172188506 20:33047630-33047652 CCTGGACGCCAGGATGCAGGTGG - Intergenic
1172436939 20:34935642-34935664 CCTGGAACACAGGATGGAGAAGG + Exonic
1173701401 20:45075062-45075084 CCTGGACCCCATGATGGAGCAGG + Exonic
1174415001 20:50360507-50360529 CCTTGACCCCAGGCTGCTGACGG - Intergenic
1174442876 20:50569953-50569975 CCTGGGCCACACGCTCCTGCTGG - Intronic
1175061543 20:56248174-56248196 CCTGGCCCTGAGGATTCTGCAGG - Intergenic
1175388877 20:58614032-58614054 CCTAGAGCACTGGATGCTGGGGG + Intergenic
1175448376 20:59042393-59042415 CCAGGACCTCAGGAGGCCGCCGG + Intronic
1175510079 20:59518188-59518210 CCTGGTCGACAAGATGCTCCTGG + Intergenic
1176114417 20:63425017-63425039 CCTGGGCCACCGGGAGCTGCAGG - Intronic
1176144953 20:63561435-63561457 CCTGCACCACCGGATCCGGCAGG - Exonic
1179167298 21:38944916-38944938 CCTGGACCAGAGCGTGCTGTAGG + Intergenic
1179457638 21:41509862-41509884 CCTGCCCCACAGGAGGCTTCCGG - Intronic
1179615407 21:42580150-42580172 CCTGGCCCCCAGAAGGCTGCGGG + Intronic
1180176503 21:46093040-46093062 GCTGGACCCCAGCAGGCTGCAGG - Intergenic
1180499748 22:15921210-15921232 ACTGCACCCCAGGATTCTGCAGG - Intergenic
1183384197 22:37505670-37505692 CGTGGTCCTCAGGCTGCTGCCGG - Intronic
1183650265 22:39149602-39149624 CCTGGACCACAGGAGGGTCAAGG - Intronic
1183861802 22:40675680-40675702 CCTGCAACACAGGATGTAGCTGG + Intergenic
1184597916 22:45525531-45525553 CCTCACCCACAGGATGGTGCAGG + Exonic
1185006242 22:48278481-48278503 CCTGGGCCAGACGCTGCTGCAGG + Intergenic
1185323764 22:50215695-50215717 CCTGGAACACAGGCTGCTCAGGG - Exonic
950073371 3:10170142-10170164 CATAAGCCACAGGATGCTGCAGG - Intronic
950112587 3:10429031-10429053 GCTGGACAACAGGAGGCTGCAGG - Intronic
950624014 3:14231042-14231064 CCTTGACCACTGAATGCTGGGGG + Intergenic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
960759063 3:121052236-121052258 CCTGGATGCCAGGATGATGCGGG - Intronic
961477501 3:127157838-127157860 CCTGCACCACTGTCTGCTGCCGG + Intergenic
961727966 3:128945294-128945316 CCTGCTCCACAGCCTGCTGCAGG - Exonic
962272116 3:133984949-133984971 CTTGCACCACAGAATGTTGCAGG + Intronic
963042214 3:141078214-141078236 CCTGGACCTCAGTATCCTTCAGG + Intronic
963851762 3:150216695-150216717 CTTTCACCACAGGGTGCTGCAGG - Intergenic
968652385 4:1765389-1765411 CCTGGGCCACAAAAAGCTGCAGG + Intergenic
968967426 4:3776208-3776230 CCAGCACCACAGGATGCCCCTGG + Intergenic
972297873 4:37757339-37757361 CCTAAACCACAGAATGCGGCTGG + Intergenic
972809480 4:42566425-42566447 CCTGGAGCACAGGATTCAACTGG + Intronic
974916250 4:68182369-68182391 CCTGGTCCACCGGCAGCTGCGGG + Intergenic
975089933 4:70389795-70389817 CCTGGACCATAGGGTGCGGGAGG - Exonic
978676495 4:111325427-111325449 CCAGAACCACAGGGTGCTCCTGG - Intergenic
983634988 4:169888503-169888525 TGTGGGCCACAGGATTCTGCAGG - Intergenic
983692092 4:170482649-170482671 GCTGGAGCGCTGGATGCTGCTGG - Intergenic
984937057 4:184898576-184898598 CCAGGGCCACAGGAAGCAGCTGG + Intergenic
986564673 5:9100296-9100318 CTGGGACCACAGGAGGCTGAGGG - Intronic
986637523 5:9837578-9837600 CCAGGCCCACAGGAAGGTGCAGG - Intergenic
997641313 5:135450670-135450692 CCTGGGCCACAGGGTGCTGGTGG - Intronic
998147770 5:139740028-139740050 CCTGGGCTACAGGTTGATGCAGG + Intergenic
999408300 5:151326436-151326458 CCAGGAACACAGGGTGCTGGTGG + Intronic
1003160010 6:3626400-3626422 CCTGGCTCCCAGGATGCCGCAGG - Intergenic
1003236502 6:4299994-4300016 ACTGGACTGCAGCATGCTGCTGG + Intergenic
1003573293 6:7269962-7269984 CAAGGACCACATGGTGCTGCTGG - Intronic
1006177661 6:32132297-32132319 CCTGCTCCACTGGATGTTGCAGG + Intergenic
1006507563 6:34499381-34499403 CCTGGGCCACAGATTGCTACTGG - Intronic
1006516113 6:34546670-34546692 TCTCCACCACAGGAAGCTGCAGG - Intronic
1007706066 6:43792169-43792191 CCTGGCCCTCAGGATGCTCCCGG + Intergenic
1011905483 6:92362076-92362098 CCTGGGCAGCAGAATGCTGCTGG + Intergenic
1014975367 6:127874886-127874908 CCTGGGCCACAGACTGGTGCTGG + Intronic
1017870425 6:158482066-158482088 CCAGGCCCACAGGATTCAGCGGG - Intronic
1018747968 6:166777113-166777135 GCTGGACCTGAGGTTGCTGCGGG + Intronic
1019180499 6:170184593-170184615 CCAGGGCCACAGGAAGCTGGTGG - Intergenic
1019645451 7:2126431-2126453 CCTGGACCCCAGGAGCCTGGAGG + Intronic
1019991861 7:4697372-4697394 TCTGGCCCACAGGCTGCAGCTGG - Intronic
1020278105 7:6636944-6636966 CCGGGACCCCAGGATGGTGGAGG - Intergenic
1021585559 7:22203736-22203758 CCTGGTCCACAGCATGCAGGTGG - Intronic
1021612311 7:22470190-22470212 CCTGCACCACAAGATACTCCAGG - Intronic
1022441456 7:30436607-30436629 CCTTGTCCTCAGGATGATGCTGG - Intronic
1023888645 7:44377533-44377555 ACTGGAGCAGAGGCTGCTGCTGG - Intergenic
1024058658 7:45682456-45682478 GCTGGACCCCGGGGTGCTGCAGG + Intronic
1024618132 7:51133082-51133104 CCTGGACCCTAGGCAGCTGCTGG - Intronic
1024896526 7:54267594-54267616 CATGGACCATAGGATCCTGAGGG - Intergenic
1030098967 7:105927879-105927901 CCTGGAAAACATGATGCTGAGGG + Intronic
1031601677 7:123717487-123717509 CTTGGACCACATGATGCATCCGG + Intronic
1033705119 7:143879075-143879097 CCTGGCAGACGGGATGCTGCAGG - Intronic
1034082510 7:148292711-148292733 CGTGAACCCAAGGATGCTGCAGG + Intronic
1035994841 8:4534241-4534263 CCTGGCCCCAAGGATGCTGAAGG + Intronic
1037891137 8:22624284-22624306 GCAGGACTACAGGAGGCTGCAGG - Exonic
1039063705 8:33592027-33592049 CCTGGACCGCAGGCTGCGGCAGG - Exonic
1043175090 8:77015410-77015432 CCAGGAGCACAGGATTCTGGTGG - Intergenic
1047555208 8:125921785-125921807 CATGGGGCACAGGATGCAGCGGG - Intergenic
1049167057 8:141133073-141133095 CCAGGACCACAGGCTCCTCCAGG - Intronic
1049291088 8:141802351-141802373 CCTGGACCCGAGGGTGCTGGCGG + Intergenic
1049336818 8:142091012-142091034 CCAGGACTGCAGGATGCTGGAGG + Intergenic
1049680136 8:143914541-143914563 CCTGGACCAGTGGCTACTGCAGG + Intergenic
1049817966 8:144616757-144616779 CCTGCACCACAGGATGCCACTGG - Intergenic
1050457413 9:5847280-5847302 CCTGGACAACAGAATGAGGCTGG - Intergenic
1051619038 9:19033207-19033229 ACTGGGCCCCAGGAAGCTGCGGG + Intronic
1052865774 9:33463896-33463918 CCAGGACCACAAGCTGCTGCAGG + Exonic
1055708369 9:79033136-79033158 CCTGGACCACAGATAGCTTCTGG - Intergenic
1057277163 9:93682077-93682099 CCAGGACTACAGCCTGCTGCTGG + Intergenic
1057477276 9:95413411-95413433 CCTGCACCACTGGCGGCTGCTGG - Intergenic
1057719854 9:97523325-97523347 CCTGGTCCCCAGGGTCCTGCTGG + Intronic
1058052444 9:100420471-100420493 CCTGGACAGCTGGATTCTGCAGG + Intergenic
1060588515 9:124801590-124801612 CCCGGATCACAGCCTGCTGCTGG - Exonic
1060986048 9:127819571-127819593 CCTGGCCCAGGGGCTGCTGCTGG - Intronic
1061172306 9:128966508-128966530 CTAGGACTACAAGATGCTGCAGG + Intronic
1061216511 9:129224838-129224860 CCTGGACCACAGGACGCCCCTGG - Intergenic
1061487164 9:130925731-130925753 CCTGGGCTTCAGGAGGCTGCAGG + Intronic
1062154599 9:135039641-135039663 CATGCACCACTGGAGGCTGCAGG - Intergenic
1062402875 9:136380129-136380151 CCTGAACCGCAGGCTGCTGCTGG + Intronic
1062403313 9:136381902-136381924 CCTGAACCGCAGGCTGCTGCTGG - Exonic
1062745943 9:138212072-138212094 CCTGGAGCCCAGGCTGCTCCAGG + Intergenic
1185519021 X:724543-724565 CCTGGATCACAGGTAGATGCTGG - Intergenic
1186025750 X:5309288-5309310 CCTTGAGCACAGAATTCTGCTGG - Intergenic
1187556615 X:20358046-20358068 CCTGGTGCAGTGGATGCTGCTGG + Intergenic
1187614369 X:20977083-20977105 CCTGGACCCAAGGAATCTGCAGG + Intergenic
1189844874 X:45126365-45126387 CTGGCACCACAGGATGCTCCAGG + Intergenic
1190066779 X:47247114-47247136 GCTGGACCTGTGGATGCTGCCGG + Exonic
1190749363 X:53347545-53347567 CTGGCACCACAAGATGCTGCAGG - Intergenic
1195249754 X:103031679-103031701 CCAGGACCACATGATGGTGAAGG - Intergenic
1201372068 Y:13276581-13276603 CCGGGACTACAGGTTGCAGCTGG - Intronic
1201794097 Y:17875893-17875915 CTTGGGCCACAGGATTGTGCAGG + Intergenic
1201807457 Y:18030092-18030114 CTTGGGCCACAGGATTGTGCAGG - Intergenic
1202339915 Y:23852849-23852871 CATGGGCCACAGGATTGTGCAGG + Intergenic
1202530851 Y:25817233-25817255 CATGGGCCACAGGATTGTGCAGG - Intergenic