ID: 907306721

View in Genome Browser
Species Human (GRCh38)
Location 1:53517394-53517416
Sequence CGGTGTTTGTGGAGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907306715_907306721 2 Left 907306715 1:53517369-53517391 CCAGCTTGGGGGAAGGTGCCTCA 0: 1
1: 0
2: 0
3: 20
4: 162
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306710_907306721 11 Left 907306710 1:53517360-53517382 CCTACCTCCCCAGCTTGGGGGAA 0: 1
1: 0
2: 0
3: 30
4: 246
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306703_907306721 30 Left 907306703 1:53517341-53517363 CCTGTCTGTCCAGCCACTGCCTA 0: 1
1: 0
2: 1
3: 16
4: 240
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306713_907306721 4 Left 907306713 1:53517367-53517389 CCCCAGCTTGGGGGAAGGTGCCT No data
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306714_907306721 3 Left 907306714 1:53517368-53517390 CCCAGCTTGGGGGAAGGTGCCTC 0: 1
1: 0
2: 2
3: 36
4: 795
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306705_907306721 17 Left 907306705 1:53517354-53517376 CCACTGCCTACCTCCCCAGCTTG 0: 1
1: 0
2: 11
3: 115
4: 841
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306704_907306721 21 Left 907306704 1:53517350-53517372 CCAGCCACTGCCTACCTCCCCAG 0: 1
1: 0
2: 6
3: 84
4: 748
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data
907306712_907306721 7 Left 907306712 1:53517364-53517386 CCTCCCCAGCTTGGGGGAAGGTG 0: 1
1: 0
2: 3
3: 47
4: 373
Right 907306721 1:53517394-53517416 CGGTGTTTGTGGAGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907306721 Original CRISPR CGGTGTTTGTGGAGGGAGCC TGG Intronic
No off target data available for this crispr