ID: 907309493

View in Genome Browser
Species Human (GRCh38)
Location 1:53531149-53531171
Sequence CAGGTGACCCTTGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907309483_907309493 20 Left 907309483 1:53531106-53531128 CCAAAGGCCAGGTGGCTCTGCTA No data
Right 907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG No data
907309484_907309493 13 Left 907309484 1:53531113-53531135 CCAGGTGGCTCTGCTATGCCTGC No data
Right 907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG No data
907309488_907309493 -5 Left 907309488 1:53531131-53531153 CCTGCTGCCTTCCTAGGGCAGGT 0: 1
1: 0
2: 0
3: 28
4: 292
Right 907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907309493 Original CRISPR CAGGTGACCCTTGAGGAGGA AGG Intronic
No off target data available for this crispr