ID: 907310383

View in Genome Browser
Species Human (GRCh38)
Location 1:53535629-53535651
Sequence CCACCTTGTAATCACCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907310372_907310383 25 Left 907310372 1:53535581-53535603 CCCTCCTCTCTGGGCCCTGCATC No data
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310379_907310383 -8 Left 907310379 1:53535614-53535636 CCAGCCCAGGAAATGCCACCTTG No data
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310373_907310383 24 Left 907310373 1:53535582-53535604 CCTCCTCTCTGGGCCCTGCATCC 0: 1
1: 4
2: 16
3: 96
4: 1108
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310376_907310383 10 Left 907310376 1:53535596-53535618 CCTGCATCCAACTAGTCACCAGC No data
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310375_907310383 11 Left 907310375 1:53535595-53535617 CCCTGCATCCAACTAGTCACCAG 0: 1
1: 0
2: 1
3: 12
4: 144
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310378_907310383 3 Left 907310378 1:53535603-53535625 CCAACTAGTCACCAGCCCAGGAA No data
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data
907310374_907310383 21 Left 907310374 1:53535585-53535607 CCTCTCTGGGCCCTGCATCCAAC 0: 1
1: 1
2: 2
3: 28
4: 295
Right 907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907310383 Original CRISPR CCACCTTGTAATCACCTTCC AGG Intronic
No off target data available for this crispr