ID: 907310855

View in Genome Browser
Species Human (GRCh38)
Location 1:53538254-53538276
Sequence CCGTGAGGCTCTCGAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907310845_907310855 24 Left 907310845 1:53538207-53538229 CCTGGGGGTGAGGCTGGAGGGCA No data
Right 907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 86
907310849_907310855 -3 Left 907310849 1:53538234-53538256 CCCGGGCTCTTTGATTTGGACCG No data
Right 907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 86
907310850_907310855 -4 Left 907310850 1:53538235-53538257 CCGGGCTCTTTGATTTGGACCGT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907310855 Original CRISPR CCGTGAGGCTCTCGAGGGTC TGG Intronic
900680240 1:3912449-3912471 CCGTCAGGCTCAGGAGGGGCAGG - Intergenic
902199967 1:14826109-14826131 CCATGTGGCTCTCGATGGGCAGG - Intronic
902290065 1:15429530-15429552 CCCTGAGGGTCTCGGGGCTCTGG + Exonic
902918071 1:19650693-19650715 GGGTGAGGCTCTCAAGGCTCAGG + Intronic
903362474 1:22785181-22785203 CCATGAGGCACTCTAGGGCCAGG + Intronic
907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG + Intronic
908371640 1:63486320-63486342 CCTTGAGGAACTCGAGGGTTAGG + Intronic
916268934 1:162919580-162919602 CCCTCAGGCTCTGGAGGGTATGG - Intergenic
916613517 1:166416718-166416740 CAGTTAGGCACTCGGGGGTCAGG + Intergenic
916679230 1:167089168-167089190 CCTTGGGGCTCTCGAGGGAAGGG - Intronic
916812055 1:168314318-168314340 CTGTAAGCCTCTCGAGGGTGAGG + Exonic
920017748 1:202927198-202927220 CCCGGAGGCTCTGGAGGCTCTGG + Exonic
920250949 1:204622143-204622165 CCCTGGGCCTCTGGAGGGTCTGG + Exonic
922983747 1:229850504-229850526 CCATGAGGCTGTAGAGGTTCTGG + Intergenic
1063207301 10:3845505-3845527 CCATGAGGATCTAGAGGGTATGG + Intergenic
1066489793 10:35883403-35883425 CCGTGAGCCCCTCCAGGGTAGGG + Intergenic
1073081788 10:100865136-100865158 CAGTGAGGCTCTCCTGGCTCTGG - Intergenic
1076741586 10:132488359-132488381 CCCTGAGGCTCTGCGGGGTCCGG + Intergenic
1076884214 10:133254277-133254299 CCCTGAGGCTCCTGAGGCTCTGG + Intergenic
1077045727 11:544451-544473 CCGTGAGGCTTTGGGGGCTCAGG + Intronic
1078355595 11:10629487-10629509 CCCTGAGCCCCTCTAGGGTCGGG - Intronic
1079586359 11:22130209-22130231 CAGTGAGGATCCAGAGGGTCAGG - Intergenic
1080432712 11:32213412-32213434 GGCTGAGGCTCTCGAGGGGCTGG + Intergenic
1081668946 11:44932786-44932808 CCATGAGGCTGTCCAGGCTCTGG - Exonic
1082023216 11:47552492-47552514 ACGAGGGGCTCTCGAGGCTCGGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1095446394 12:42287066-42287088 CCGAGAGGGTCTCGATGGTGCGG - Intronic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1099514862 12:83584973-83584995 CTGTTAGGCTGTCGGGGGTCAGG - Intergenic
1102989475 12:117304493-117304515 CCGTGAGGGTCTCAAGGGCAGGG + Intronic
1107670584 13:42742838-42742860 CTGTGTGGCTCTGGAGGGTCTGG + Intergenic
1125920647 15:43523558-43523580 CCGGGAGGCTTTTGGGGGTCGGG + Exonic
1129269243 15:74410812-74410834 CCGTGAGGTTCTCGATGAACAGG + Exonic
1132320291 15:100919935-100919957 CCGGGAGCCTCTCGCTGGTCCGG + Intronic
1132576859 16:668283-668305 GGGTGAGGGTCTCGGGGGTCGGG + Intronic
1136116701 16:28099154-28099176 TCGGGTGGCTCTCGAGGGGCAGG - Intronic
1142848830 17:2694674-2694696 CCGGGAGGCTCCCGGGGGCCGGG - Intronic
1143086100 17:4417219-4417241 CAGTGAGGCTCTCGAGGGAAAGG - Intergenic
1145828612 17:27897089-27897111 CTATGAGGCCCTCCAGGGTCTGG + Intergenic
1146842974 17:36167685-36167707 TCGTGAGGCGCTCTAGGGACAGG + Exonic
1146855279 17:36255626-36255648 TCGTGAGGCGCTCTAGGGACAGG + Exonic
1146865341 17:36332749-36332771 TCGTGAGGCGCTCTAGGGACAGG - Exonic
1146871185 17:36379537-36379559 TCGTGAGGCGCTCTAGGGACAGG + Exonic
1146878544 17:36430619-36430641 TCGTGAGGCGCTCTAGGGACAGG + Exonic
1146882494 17:36451765-36451787 TCGTGAGGCGCTCTAGGGACAGG + Intergenic
1147068202 17:37933343-37933365 TCGTGAGGCGCTCTAGGGACAGG - Exonic
1147074070 17:37980161-37980183 TCGTGAGGCGCTCTAGGGACAGG + Intronic
1147079733 17:38012898-38012920 TCGTGAGGCGCTCTAGGGACAGG - Intronic
1147085592 17:38059699-38059721 TCGTGAGGCGCTCTAGGGACAGG + Exonic
1147095674 17:38136840-38136862 TCGTGAGGCGCTCTAGGGACAGG - Intergenic
1147101539 17:38183665-38183687 TCGTGAGGCGCTCTAGGGACAGG + Intergenic
1149846138 17:60010171-60010193 TCGTGAGGCGCTCTAGGGACAGG + Intergenic
1150003829 17:61457533-61457555 CCTTGATGTTCTCGATGGTCTGG - Exonic
1150084487 17:62266751-62266773 TCGTGAGGCGCTCTAGGGACAGG + Intergenic
1151474462 17:74337912-74337934 GGGTGATGCTCTCGAGGGTGGGG + Intronic
1151821420 17:76499039-76499061 CTGTGAGCCTCTCAAGGGACAGG - Intronic
1153020474 18:624090-624112 CCGTGAGGCACTCCAGGGGCAGG + Intronic
1153944952 18:10009956-10009978 CCGTGGTCCTCTCCAGGGTCCGG + Intergenic
1161038457 19:2097844-2097866 CCCTGAGGCTTTGGAGGGTTGGG + Intronic
1163828883 19:19538443-19538465 CCCTGAGGCTCCCGAGGGCCTGG + Intronic
1164523730 19:28998461-28998483 CCGCAAGGCTTTCGATGGTCAGG - Intergenic
1166415662 19:42593334-42593356 CCGTGAGTGTCTGCAGGGTCTGG + Intronic
1167124520 19:47540028-47540050 CTGTGTGGCTCTCCAGGGGCAGG - Intronic
926035957 2:9635881-9635903 CCATGAGCCTCTTGAGGGTAAGG + Intergenic
926526223 2:13984662-13984684 GCATGAGGCTCTCGGGGTTCTGG - Intergenic
943559265 2:189441617-189441639 GCGTGAGTTTCTCGAGGGTCGGG + Intronic
1172422004 20:34825610-34825632 CCGTGAGGCCCTGCCGGGTCGGG - Intronic
1175831794 20:61968633-61968655 CCAGGAGGCTCCCCAGGGTCCGG + Intronic
1176380985 21:6111851-6111873 CCGCGGGGCTCAAGAGGGTCGGG + Intronic
1178966185 21:37120696-37120718 CCGTGTGGCTCTAAAGGTTCTGG - Intronic
1179290391 21:40013249-40013271 CCGTGGGGCGCTTCAGGGTCCGG + Exonic
1179742487 21:43426389-43426411 CCGCGGGGCTCAAGAGGGTCGGG - Intronic
1183671194 22:39273963-39273985 CCTGGGGGCTCTGGAGGGTCCGG - Intergenic
954878964 3:53821179-53821201 CTCTGATGCTCTTGAGGGTCGGG - Intronic
960155220 3:114291817-114291839 GCAGGAGGCTCTGGAGGGTCTGG + Intronic
961771362 3:129252519-129252541 CCTTGAGCCTCTTTAGGGTCTGG + Intronic
969816396 4:9691136-9691158 CCCTGAGACCCTGGAGGGTCTGG + Intergenic
974112072 4:57537271-57537293 CAGTTAGGCTCTCGGGGGTCAGG + Intergenic
985387649 4:189463927-189463949 CGGTGAGGCCCTCATGGGTCGGG - Intergenic
992753991 5:79887124-79887146 TCGTGAGGCTCTCAAGGGACAGG + Intergenic
1004688661 6:17972946-17972968 CCATGGGGCTCTTCAGGGTCTGG - Intronic
1005915140 6:30345060-30345082 CCGGGAGGCTCCCGAGGGCGCGG + Intronic
1006378840 6:33686199-33686221 CAGTGAGGGTCTCCAAGGTCTGG - Exonic
1012225576 6:96699833-96699855 CCATCAGGCCCTCCAGGGTCTGG - Intergenic
1019137623 6:169921045-169921067 CTGTGAGTCTGTCCAGGGTCAGG - Intergenic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1023835461 7:44064955-44064977 CCTTGAGGCTCTCGCAGGTGGGG + Exonic
1037744232 8:21630355-21630377 CCCTGAAGCACTCCAGGGTCAGG - Intergenic
1041360245 8:57045467-57045489 CCTGGAGGCTCTTGGGGGTCTGG - Intergenic
1049371751 8:142271251-142271273 CCACCAGCCTCTCGAGGGTCCGG + Intronic
1058036484 9:100258844-100258866 CCGTTAGGCTATTGGGGGTCAGG + Intronic
1060802440 9:126553323-126553345 GCGTCAGGCTCCCGAGGGTTGGG - Intergenic
1062002475 9:134223659-134223681 CGCTGAGGCTCTCCAAGGTCAGG + Intergenic
1189847289 X:45149242-45149264 CCGTGGGACTCTGGAGGGTCTGG + Exonic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic
1197746104 X:129932798-129932820 CCGCGAGGCTTCCGAGGGCCAGG - Intergenic