ID: 907312334

View in Genome Browser
Species Human (GRCh38)
Location 1:53546063-53546085
Sequence GACAGTGGTGTGCCTGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907312330_907312334 13 Left 907312330 1:53546027-53546049 CCAACTTGCCGAAGGGCAGGGGA No data
Right 907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG No data
907312331_907312334 5 Left 907312331 1:53546035-53546057 CCGAAGGGCAGGGGATACAGCTC 0: 1
1: 0
2: 1
3: 19
4: 303
Right 907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907312334 Original CRISPR GACAGTGGTGTGCCTGCATC AGG Intronic
No off target data available for this crispr