ID: 907313313

View in Genome Browser
Species Human (GRCh38)
Location 1:53552236-53552258
Sequence CACCTATAGCAGCTTAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 68}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907313313_907313320 0 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313320 1:53552259-53552281 GAAAGTGTGTCCCGGTAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 95
907313313_907313326 11 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313326 1:53552270-53552292 CCGGTAGGAGGGGGACCAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 268
907313313_907313317 -8 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313317 1:53552251-53552273 TATAGGTGGAAAGTGTGTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 129
907313313_907313318 -4 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313318 1:53552255-53552277 GGTGGAAAGTGTGTCCCGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 104
907313313_907313321 1 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313321 1:53552260-53552282 AAAGTGTGTCCCGGTAGGAGGGG 0: 1
1: 0
2: 1
3: 3
4: 78
907313313_907313322 2 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313322 1:53552261-53552283 AAGTGTGTCCCGGTAGGAGGGGG No data
907313313_907313319 -1 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313319 1:53552258-53552280 GGAAAGTGTGTCCCGGTAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 116
907313313_907313323 8 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313323 1:53552267-53552289 GTCCCGGTAGGAGGGGGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 140
907313313_907313327 12 Left 907313313 1:53552236-53552258 CCAACCCTAAGCTGCTATAGGTG 0: 1
1: 0
2: 0
3: 0
4: 68
Right 907313327 1:53552271-53552293 CGGTAGGAGGGGGACCAGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907313313 Original CRISPR CACCTATAGCAGCTTAGGGT TGG (reversed) Intronic
904605035 1:31693358-31693380 CAAATATAGCATCTTGGGGTGGG - Intronic
907313313 1:53552236-53552258 CACCTATAGCAGCTTAGGGTTGG - Intronic
908013564 1:59808663-59808685 CACCCACAGTAGCTTTGGGTGGG - Intergenic
920693710 1:208165668-208165690 CCCCAAGACCAGCTTAGGGTTGG - Intronic
1062812212 10:475481-475503 CACCAAGAGGAGGTTAGGGTTGG - Intronic
1064895044 10:20226303-20226325 CAACAATAGCTGCTGAGGGTTGG - Intronic
1070129658 10:73647687-73647709 CAGCGATAGCAGCTCGGGGTTGG + Exonic
1074948084 10:118300673-118300695 CACCTATAGGAGCTTAGCCCTGG + Exonic
1077005436 11:353229-353251 CACCAATAGCAGCTCGGGCTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089534269 11:119150898-119150920 CAGCTAAAGCTGCTCAGGGTAGG - Intronic
1096462005 12:51827039-51827061 CACCTATAGCGGGCTAGGGGAGG - Intergenic
1097420036 12:59365325-59365347 CACCTTTATCAGCTGTGGGTGGG - Intergenic
1104947810 12:132424665-132424687 CACCTCTCCCAGCTTGGGGTGGG + Intergenic
1111455152 13:88473028-88473050 CACTTATAGTAGCCTAGAGTTGG - Intergenic
1122295820 14:100705143-100705165 CACCTATACCAGGGTAGGGAAGG + Intergenic
1125318637 15:38458765-38458787 CATCTATACCAGCCTTGGGTAGG - Intronic
1125433413 15:39621260-39621282 CACTTATAGGAGCTTTGGGGTGG - Intronic
1135544427 16:23356163-23356185 CACTTCTAGCAGCTGGGGGTGGG + Intronic
1138105959 16:54287192-54287214 CACTTTCAGCAGCTTAGGGAGGG + Intergenic
1144201651 17:12947463-12947485 CACCTCTAGCAGGGCAGGGTGGG - Intronic
1145759844 17:27419887-27419909 CACTTATTTCAGCTTAGGGATGG + Intergenic
1145799206 17:27672464-27672486 CACCTATCTCAGCTCAGGGCTGG - Intergenic
1150464418 17:65379869-65379891 CACCTAAGGTAGCTTAGAGTGGG + Intergenic
1157216396 18:45787052-45787074 TGCCTTTGGCAGCTTAGGGTGGG - Intergenic
1157415628 18:47500304-47500326 CACCTACAGCAGATTATGGATGG + Intergenic
1159367093 18:67482229-67482251 CACATATAGCAGTTTAGTATTGG + Intergenic
1162446812 19:10728398-10728420 CACATATGGCGGCTTTGGGTGGG + Intronic
1164784813 19:30921658-30921680 CATCTAGAACAGCTCAGGGTAGG + Intergenic
1165867399 19:38947118-38947140 CACCTCTAGCAGTCTAGGGGTGG + Intronic
1166404663 19:42511427-42511449 GACCTATGCCACCTTAGGGTTGG + Intronic
1167036084 19:46995725-46995747 CACCAGTAGCTGCTTAGGTTTGG - Intronic
928690691 2:33795424-33795446 CACTTAAAGCAGGTTAGGCTAGG - Intergenic
935869993 2:107437819-107437841 AAACTATAGCAGCTTAGGAAAGG - Intergenic
937626965 2:124054773-124054795 CACCCAGAGCAGGTGAGGGTAGG - Intronic
938240161 2:129737266-129737288 CCCTTAGAGCAGCTGAGGGTAGG - Intergenic
1168857736 20:1020619-1020641 CACCTATAGAAGCTGAGGCATGG - Intergenic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1180274280 22:10631158-10631180 CACCTTTCGCAGTTTGGGGTGGG + Intergenic
962391761 3:134978224-134978246 CAACTACAGTGGCTTAGGGTAGG - Intronic
962897699 3:139730932-139730954 CACCCTTAGCAGCATAGGGCAGG - Intergenic
967283934 3:187850432-187850454 CACCAGTAGAAGCTCAGGGTGGG + Intergenic
973661970 4:53117348-53117370 CATATACAGCAGCTTGGGGTTGG + Intronic
974139453 4:57865886-57865908 AACCTATAGAAACTTAGGGAGGG + Intergenic
980014463 4:127632904-127632926 CACCAATTGCAGCTAAGGATTGG + Intronic
984279318 4:177649938-177649960 CACATATTGCAGATGAGGGTAGG - Intergenic
985043761 4:185918658-185918680 CACCTCTTCCAGCCTAGGGTGGG + Intronic
987052567 5:14160196-14160218 CACGTAGAGCAGGTTGGGGTTGG + Intronic
988092218 5:26558455-26558477 CACAGAGAGCAGATTAGGGTCGG + Intergenic
991014995 5:61922226-61922248 CACCTGTAGCATTTTAGGGAAGG - Intergenic
992540838 5:77762037-77762059 CACCTACAGCAGCTTTGGTGGGG - Intronic
994650046 5:102515988-102516010 CTCCTATAGCATTTTAGGCTAGG - Intergenic
996287961 5:121817255-121817277 CACATATAGCAGCATATAGTAGG - Intergenic
998200961 5:140120100-140120122 CATCTGTAGCAACTTAGGTTTGG + Exonic
1000239251 5:159394207-159394229 CTGCTATAGCAGCGTAGGGAGGG + Intergenic
1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG + Intronic
1007161891 6:39798134-39798156 CAAGTATAGTAGCTTAGGGAAGG + Intronic
1010615228 6:78005090-78005112 CACTTATAGCAGCATATGTTTGG - Intergenic
1010633618 6:78230713-78230735 CACCTCTAGCAGAGTAGGGGAGG - Intergenic
1011874475 6:91940192-91940214 AACCTATAGTAGCTCAGAGTAGG + Intergenic
1013056648 6:106589638-106589660 CAACTACAGCATCATAGGGTTGG + Intronic
1022155221 7:27653946-27653968 CATCTGTTTCAGCTTAGGGTTGG - Intronic
1028717287 7:93985902-93985924 GACCTAGAGCATCTTAGAGTTGG + Intronic
1042798217 8:72687855-72687877 CAACTATAGCTCCTTAGGGCAGG - Intronic
1045593820 8:103629659-103629681 CATCTATATCATCTTAGTGTTGG - Intronic
1045611665 8:103849723-103849745 CACTTATAGCAGCTGCGGGAGGG + Intronic
1047816548 8:128470364-128470386 CACCTATAGTAGGGTAGGATAGG - Intergenic
1052836346 9:33252850-33252872 CACCTATACAAGGGTAGGGTTGG + Exonic
1197069722 X:122281131-122281153 CACAATCAGCAGCTTAGGGTTGG - Intergenic