ID: 907315397

View in Genome Browser
Species Human (GRCh38)
Location 1:53567705-53567727
Sequence TTTTAGCCACAGCTGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 5, 2: 10, 3: 49, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907315397_907315405 -2 Left 907315397 1:53567705-53567727 CCTAGCCCCAGCTGTGGCTAAAA 0: 1
1: 5
2: 10
3: 49
4: 226
Right 907315405 1:53567726-53567748 AAGGGGCCAAGGTACAAGTCAGG 0: 1
1: 24
2: 433
3: 982
4: 1497
907315397_907315408 14 Left 907315397 1:53567705-53567727 CCTAGCCCCAGCTGTGGCTAAAA 0: 1
1: 5
2: 10
3: 49
4: 226
Right 907315408 1:53567742-53567764 AGTCAGGTCATTGCTTCAGAGGG 0: 1
1: 3
2: 72
3: 395
4: 876
907315397_907315407 13 Left 907315397 1:53567705-53567727 CCTAGCCCCAGCTGTGGCTAAAA 0: 1
1: 5
2: 10
3: 49
4: 226
Right 907315407 1:53567741-53567763 AAGTCAGGTCATTGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907315397 Original CRISPR TTTTAGCCACAGCTGGGGCT AGG (reversed) Intronic
901781849 1:11599420-11599442 TTTTGGCCACCACAGGGGCTGGG + Intergenic
902642185 1:17774168-17774190 GTTTAGCTCCAGCAGGGGCTTGG + Intronic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
905798909 1:40831030-40831052 AGTTAGCCAGAGCTGGGGGTGGG - Intronic
906026080 1:42675301-42675323 TGTTAGCCACAGCTGTGGGCAGG - Intronic
906117554 1:43366593-43366615 TTTGGGCCAGGGCTGGGGCTGGG - Intronic
906199913 1:43953328-43953350 TTATGACCACAGCTGAGGCTGGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907047116 1:51306100-51306122 TTTCAGCCACTGCTGGGGGTGGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
910570441 1:88695507-88695529 TTTGAGCCACAACTGGGGAATGG - Intronic
911205186 1:95085529-95085551 CCTTAGCCACAGCTGGAGTTTGG - Intergenic
912693697 1:111824025-111824047 TTTTAGGAAAAGCTGAGGCTTGG + Intronic
912712884 1:111962072-111962094 TCTTAGCCATCACTGGGGCTTGG - Intronic
913383892 1:118239083-118239105 TTTTAGCCACAGCTGGGATGTGG - Intergenic
914194892 1:145442055-145442077 TCTGAGCCATAGCTGGGGCAAGG - Intergenic
914476166 1:148024622-148024644 TCTGAGCCATAGCTGGGGCAAGG - Intergenic
915369237 1:155334139-155334161 TTTAAGAAATAGCTGGGGCTGGG + Intergenic
915504015 1:156340754-156340776 TTTATGCCCAAGCTGGGGCTGGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916292193 1:163179013-163179035 TTTTTGCCACAGTTGGGAGTTGG - Intronic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
918107785 1:181428368-181428390 TTTTATCCAGAGCTAGGGCAAGG + Intronic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919969169 1:202561863-202561885 TATTTGCCATAGCTGGGGGTGGG - Intronic
921306111 1:213798530-213798552 GTTCAGCCACAGCTAAGGCTGGG - Intergenic
922331397 1:224580063-224580085 TTCTAGGCACAGCTGAGGGTAGG - Intronic
923442739 1:234036852-234036874 TTTTCCCCACTGCTGGGTCTAGG + Intronic
923686650 1:236158126-236158148 ATTAAACCACAGCTGGGGCTGGG + Intronic
923862020 1:237900776-237900798 TTTGACCCAGAGTTGGGGCTAGG - Intergenic
924931094 1:248733074-248733096 TTTTAGCCACAGTGGGGACTTGG - Intronic
1064542890 10:16423162-16423184 TTGTAGGCACAGCGTGGGCTGGG - Intergenic
1065408114 10:25390967-25390989 TTTTAGCCACAGCTGACACACGG - Intronic
1068386139 10:56330281-56330303 TCTGAGTCACACCTGGGGCTGGG + Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069556681 10:69402823-69402845 TTAGAGCCGCAGCTGTGGCTTGG - Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1070806264 10:79272889-79272911 TGGTGACCACAGCTGGGGCTGGG - Intronic
1071728740 10:88226410-88226432 TTTGAGTCCCAGCTGGAGCTGGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1072508472 10:96093751-96093773 ATATAGCCACAGCGGGGGTTAGG + Intergenic
1073512284 10:104050333-104050355 TTTGTGCAACAGCAGGGGCTGGG - Intronic
1073533893 10:104257041-104257063 TTCTAGCTACAGCTGTGGATGGG + Intronic
1074879693 10:117646025-117646047 TTATAGTTACAGCTTGGGCTGGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1076142938 10:128093958-128093980 TTTTAGCCAGACCTGTGTCTGGG + Intergenic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1079090299 11:17476210-17476232 TGTCAGCCGCAGCTGGGCCTAGG - Intronic
1081363988 11:42213199-42213221 TTTGAGCCACAGGTGGAGTTGGG - Intergenic
1082228874 11:49740850-49740872 TTTTAGCCGCAGTTAGGGTTTGG + Intergenic
1083142436 11:60733199-60733221 TTTCAGCCACAACCCGGGCTCGG + Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083466698 11:62851698-62851720 TTTAACCAGCAGCTGGGGCTGGG - Intergenic
1085215546 11:74827276-74827298 TTTTAGCCACGGCTGGGGTGTGG + Intronic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1092929643 12:13303764-13303786 TTTCAGGCACAGCTGGATCTAGG + Intergenic
1096692710 12:53330913-53330935 TCTCAGCCACAGTTTGGGCTTGG - Intronic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1101876858 12:108601773-108601795 TCTTTGCCTGAGCTGGGGCTGGG - Intergenic
1104559915 12:129834291-129834313 TTTAAGCAGCAGCTGGGTCTCGG - Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107411942 13:40166102-40166124 TTTGACCCACAGCTAGGGCAGGG + Intergenic
1107908388 13:45082849-45082871 TTTTAGCCACAGCTTTGGGAAGG - Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1109997597 13:70149727-70149749 TTTCAGCTACTGCTGGGGCTAGG + Intergenic
1110712541 13:78665444-78665466 TTTGAGCCACAGCTGAAGATTGG + Intergenic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1112548577 13:100396905-100396927 TTTGAACCACAGCAGGGCCTTGG - Intronic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113927703 13:113950728-113950750 TTTCTCCCACAGCTGGGTCTGGG + Intergenic
1115009072 14:28522416-28522438 TTTTAGCCATAACTGGGATTTGG - Intergenic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1115586253 14:34816381-34816403 TTTTAGAAACATCTGGGGCTGGG - Intronic
1116296679 14:43119808-43119830 TTTTAGCCATGGCTGGGGAGTGG + Intergenic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117357385 14:54937980-54938002 TTCTAGCCACATCTGGAACTCGG - Intergenic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119916433 14:78406417-78406439 CATTAGCCACAACTGTGGCTGGG + Intronic
1122314207 14:100816020-100816042 TTTCAGGAACAGCTGAGGCTGGG + Intergenic
1122725024 14:103744854-103744876 TTTCATCCACAGCAGAGGCTAGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1124222663 15:27863570-27863592 CTTTACCCTCAGATGGGGCTTGG - Intronic
1125080353 15:35665394-35665416 TTTTAGCAGCTGCTGGGGTTTGG - Intergenic
1125323720 15:38515203-38515225 TTACAGTCAAAGCTGGGGCTAGG - Intronic
1127504996 15:59589749-59589771 TTTTGGCCACAGCTCGGGGTAGG + Intergenic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128989650 15:72249009-72249031 TTTTATTCATAGCAGGGGCTTGG - Intronic
1129271191 15:74420097-74420119 TTTTGGTCAGAGCTGGAGCTTGG - Intronic
1133630821 16:7619347-7619369 TTTTAGCCATAGCAGGGGAAGGG + Intronic
1134032686 16:11005135-11005157 TGTTAGTCACAGCTGAGGCCTGG - Intronic
1135842038 16:25885654-25885676 TATTAATCACAGCTGGTGCTTGG - Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1137043976 16:35639369-35639391 TCTCAGCCCCAGCTGGGCCTTGG + Intergenic
1138163725 16:54780224-54780246 ATTCAGCCACAGCTTAGGCTAGG + Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139777363 16:69324801-69324823 TTTGAGGCAGAGCTTGGGCTGGG - Exonic
1142510416 17:389387-389409 TTATTGTCACAGCTGGGGGTTGG - Intergenic
1142798109 17:2324938-2324960 TCTTAGCCTCAGATTGGGCTAGG - Exonic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150340411 17:64362185-64362207 TTTTAGGCCCAGATGGGGCCAGG - Intronic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1150371692 17:64644272-64644294 TTTAAGACATAGCTGAGGCTGGG - Intronic
1151476417 17:74346526-74346548 TACCAGCCACAGCTGGGCCTGGG + Intronic
1152549177 17:81020868-81020890 TTTGCTCCACAGCTGAGGCTGGG + Intergenic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1156130236 18:33963904-33963926 TGTTAGACACAGCTGCGGTTGGG + Intronic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1158566557 18:58559223-58559245 TGATAGCCACAACTGGGGTTGGG + Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1162153886 19:8663884-8663906 TTTTAGTGGGAGCTGGGGCTTGG + Intergenic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1163196271 19:15723304-15723326 TTTCAGACACAGCTGGGGTGGGG + Intergenic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1164606593 19:29603455-29603477 AATTGGCCACAGCTGGCGCTAGG - Intergenic
1166408237 19:42539120-42539142 TTCTAGACACATCTGAGGCTTGG - Intronic
1167428181 19:49440398-49440420 TTAGAGCCAAAGCTGGGGTTGGG + Intronic
1167613246 19:50517412-50517434 TTCCAGCCCCATCTGGGGCTCGG - Exonic
1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG + Exonic
1168156173 19:54473955-54473977 TTTTACCCCTAGCTGGGGCTGGG + Intergenic
1168498412 19:56873420-56873442 TTTTACCCACTGGTGTGGCTTGG + Intergenic
926406567 2:12559036-12559058 GTTTGGCCACTGGTGGGGCTCGG - Intergenic
927685409 2:25167571-25167593 TTTTAACCCCAGCTAGGTCTTGG + Intronic
931828302 2:66024544-66024566 TGTTAGCCACAGCTGGCACCAGG + Intergenic
931870209 2:66448303-66448325 TTTAAAACACAGCTGTGGCTGGG + Intronic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
935941580 2:108244578-108244600 TTTTAGCTACAGTTAGGGTTTGG + Intergenic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
941178451 2:162230007-162230029 TTTCAGGCACAGATTGGGCTGGG + Intronic
941333784 2:164213848-164213870 TTTTGGTCACAACTGGGGCTTGG - Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
942307805 2:174625668-174625690 TTTTAGTCTCAGTTTGGGCTAGG + Intronic
943491701 2:188561749-188561771 TGGTAGCCACATCTTGGGCTGGG + Intronic
943652264 2:190469891-190469913 TTTTAGCCACAGCTCAGGGAAGG - Intronic
944110347 2:196125004-196125026 GTTGAGCCACAGCTGGAGATTGG + Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
945138629 2:206658996-206659018 TTTTTGCCACAGCAGAGGCAAGG + Intronic
945853173 2:215034487-215034509 TTTTAGTCACTGATGGAGCTTGG - Intronic
946952407 2:224891786-224891808 TTTAAGTCAGATCTGGGGCTAGG + Intronic
948372331 2:237497272-237497294 ACTGGGCCACAGCTGGGGCTTGG + Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948837677 2:240633957-240633979 TTTTAGCCACTGCTGGGATGTGG - Intergenic
1169060095 20:2654802-2654824 TGTAAAGCACAGCTGGGGCTGGG + Exonic
1169303917 20:4471745-4471767 TTTGGGCCAAACCTGGGGCTAGG - Intergenic
1169475711 20:5929522-5929544 TTTTTGCCTCTGCTGGGGCTCGG - Intergenic
1172318053 20:33971670-33971692 TTCTAGCCTCAGCTGGCACTTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172619746 20:36311124-36311146 TTCTAGCCACAGCCAGGGTTAGG + Intronic
1173196670 20:40919695-40919717 TATTAATCACAGCTGTGGCTGGG + Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1173475438 20:43355882-43355904 TTCAAGCCACAGCTGTGGCTGGG + Intergenic
1174578921 20:51557082-51557104 TTTTGGCATCAGCTGGGCCTAGG + Intronic
1175715670 20:61252972-61252994 CTTCAGCCACGGCCGGGGCTGGG - Intronic
1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG + Intronic
1177165633 21:17599773-17599795 TTATAAGTACAGCTGGGGCTGGG - Intronic
1179219749 21:39395741-39395763 TGTTTGACACAGCTGGGCCTAGG + Intronic
1183180456 22:36256508-36256530 TGGCAGCCACAGCAGGGGCTGGG + Intronic
1183205394 22:36415415-36415437 TTTTAGCAACAGCTTGGTTTGGG + Intergenic
1183747696 22:39701113-39701135 TTTTGCCCACATCTGGGGCCTGG + Intergenic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950038520 3:9904253-9904275 TTTTAACCTCAACTGGGACTTGG + Intronic
950360726 3:12447776-12447798 TTTAAGACACAGCTTAGGCTGGG - Intergenic
950653779 3:14424216-14424238 TTCAGGCCCCAGCTGGGGCTAGG + Intronic
957053024 3:75424852-75424874 TTTTAAACAAAACTGGGGCTGGG + Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
960485796 3:118251450-118251472 TTGGAGCCACAGATGGGACTGGG - Intergenic
960948312 3:122982097-122982119 TTTTAGCCACAGGTAGGACAAGG + Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
961756306 3:129129049-129129071 TCTTTGCCACACTTGGGGCTGGG + Intronic
961833629 3:129638817-129638839 TGATAGTCACAGCTTGGGCTGGG + Intergenic
962559765 3:136593090-136593112 TTTCTGCCATAGCTGGGGTTGGG + Intronic
963042328 3:141078856-141078878 TTTTCCCGACAGCAGGGGCTGGG + Intronic
963613340 3:147501542-147501564 TCTTAGCCACAGCTGAGAATGGG + Intronic
963640731 3:147858494-147858516 TTTGAGCCGCAGCTGGAGCTGGG + Intergenic
964442283 3:156724625-156724647 TTTTTGCCTCAGCAGGGGTTAGG - Intergenic
966020283 3:175201348-175201370 TTTTAGCTACTGATGGGGGTGGG - Intronic
968444907 4:647286-647308 TTTTGGCCAAAGCAGGGACTGGG + Intronic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969225142 4:5791669-5791691 TGTTACTCACAGCTGGGCCTGGG + Intronic
969712513 4:8852080-8852102 TTGGAGCCAGAGCCGGGGCTTGG - Intronic
970599938 4:17633731-17633753 GTCCGGCCACAGCTGGGGCTTGG + Exonic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971369256 4:26002642-26002664 TTTTGGCCAAGTCTGGGGCTAGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
974075796 4:57167137-57167159 TCTTAGCCAAAGCTGAGGCCAGG - Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
976680787 4:87753660-87753682 TTTTAGCCATGGCTGGGACGTGG + Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
979864743 4:125739730-125739752 TTTTTCTCACAGCTGTGGCTAGG + Intergenic
981319576 4:143375868-143375890 TTGTTGTCACAGCTGGGGATGGG - Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
984131288 4:175878555-175878577 TTTTAGCCACAGCTGGGACAGGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
993652199 5:90535710-90535732 TGTTAGCCACTGCAGGGACTTGG + Intronic
995591615 5:113705792-113705814 TGTGAGCCATGGCTGGGGCTGGG + Intergenic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
997394800 5:133550484-133550506 ATTCACCCACAGTTGGGGCTGGG - Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998561861 5:143179548-143179570 TCTTCCCCACACCTGGGGCTTGG + Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
1001018537 5:168163252-168163274 TTGGAGCCACAGCTGGGTTTGGG - Intronic
1001681239 5:173558489-173558511 TCATAGTCACAGCTGGGGATGGG - Intergenic
1002105531 5:176877827-176877849 TTGAAGCCACAGCTGGCCCTAGG + Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1006402117 6:33823882-33823904 TTTGATCCAAAACTGGGGCTGGG - Intergenic
1007004108 6:38343855-38343877 TTTTAGACACAGCAGGTGTTAGG + Intronic
1007650467 6:43417267-43417289 GTGTAGCTAGAGCTGGGGCTGGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1012130791 6:95489665-95489687 TTTGTGCCACAGCTGAGTCTGGG - Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017959111 6:159206566-159206588 TGTTGACAACAGCTGGGGCTTGG + Intronic
1018071460 6:160167834-160167856 TTCCACCCACAGCTGGGGCACGG + Intergenic
1019342556 7:515482-515504 TTTCAGCCACACCTGGGGAGGGG + Intronic
1019436766 7:1026160-1026182 TTGTATCCACAGGTAGGGCTGGG + Intronic
1019494573 7:1331787-1331809 TCTTAGCCACAGCTGCAGATGGG - Intergenic
1020089711 7:5332453-5332475 ACTTAGCCACAGCAGGAGCTGGG - Intronic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1021831942 7:24621912-24621934 TTTTTTCAACAGCTGGTGCTGGG - Intronic
1022504320 7:30901007-30901029 TTTTAGCCACGGCAGGAGCAGGG - Intergenic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1029488231 7:100856177-100856199 TTTGGGTCACAGTTGGGGCTGGG + Intronic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1030360420 7:108589764-108589786 TTTCAGGCACAGCTGGACCTAGG - Intergenic
1031315864 7:120257013-120257035 TTTTAGCTATGGCTGGAGCTGGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032239187 7:130148077-130148099 TGGAAACCACAGCTGGGGCTTGG - Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1042247206 8:66720059-66720081 TGTTAGCCAGGGCTGGGGCATGG - Intronic
1043749893 8:83922063-83922085 TTTTAGCCACAGATGAGACATGG + Intergenic
1044868660 8:96597119-96597141 TTTCAGGAACAGATGGGGCTGGG + Intronic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1046031516 8:108787823-108787845 TTGTGGCCACACCTGAGGCTAGG - Intergenic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1048468732 8:134688597-134688619 TTTGAGCCACAGCAGGTGCTTGG + Intronic
1049391057 8:142371792-142371814 TTTTAGCCTAAGCTGAGGGTTGG + Intronic
1049397416 8:142407698-142407720 CCTTGGCCACAGCTGGGTCTCGG + Intergenic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1050987547 9:12102232-12102254 TTTTAGACAGGGCTGGAGCTGGG + Intergenic
1054968496 9:71057295-71057317 TTGTAGCCCTAGCTTGGGCTTGG + Intronic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056141955 9:83690571-83690593 TTTAAGCTGCAGCAGGGGCTGGG + Intronic
1056317382 9:85403155-85403177 TGTTACCCACACCTGGGCCTGGG - Intergenic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1061929410 9:133824719-133824741 CTTTAGCCACCCCTGGGGTTAGG + Intronic
1186167049 X:6837770-6837792 TTCTAGCCACAGAAAGGGCTGGG - Intergenic
1188021628 X:25164986-25165008 TCTTAGCTACAGCTTGAGCTAGG + Intergenic
1188259727 X:28008366-28008388 TTTTAGCCAGTGCTGGAGATGGG + Intergenic
1193603472 X:83537552-83537574 TTTTAGCCTCACCTGTGGATAGG + Intergenic
1194292749 X:92095115-92095137 ATTTCACCACAGCTGGGGATTGG - Intronic
1195675855 X:107506828-107506850 TTCTGGTCACAGCAGGGGCTGGG + Intergenic
1196294122 X:113979335-113979357 TTTTGGCCAGAGGTGGGGTTTGG + Intergenic
1197111813 X:122784092-122784114 ATTGAGCAGCAGCTGGGGCTGGG - Intergenic
1197232860 X:124024803-124024825 TTTTAAGCAGAGCTGGTGCTAGG + Intronic
1199329570 X:146543088-146543110 TTTGAGCCATGGCTGGAGCTGGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1200099811 X:153684885-153684907 TTCAGGCCCCAGCTGGGGCTGGG - Intronic
1200610255 Y:5319677-5319699 ATTTCACCACAGCTGGGGATTGG - Intronic
1201911282 Y:19135776-19135798 TTGTAGGCAGAGCTGGGCCTTGG - Intergenic