ID: 907319153

View in Genome Browser
Species Human (GRCh38)
Location 1:53592035-53592057
Sequence CCTCCCATGGCCCTTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907319153_907319161 3 Left 907319153 1:53592035-53592057 CCCAGGGCAAGGGCCATGGGAGG No data
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907319153 Original CRISPR CCTCCCATGGCCCTTGCCCT GGG (reversed) Intronic
No off target data available for this crispr