ID: 907319161

View in Genome Browser
Species Human (GRCh38)
Location 1:53592061-53592083
Sequence AGGTCTGGGTCCCCAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907319142_907319161 29 Left 907319142 1:53592009-53592031 CCCACCCATCTCTGAGCATGAGT 0: 1
1: 0
2: 1
3: 22
4: 265
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319145_907319161 24 Left 907319145 1:53592014-53592036 CCATCTCTGAGCATGAGTGTCCC 0: 1
1: 1
2: 6
3: 112
4: 813
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319144_907319161 25 Left 907319144 1:53592013-53592035 CCCATCTCTGAGCATGAGTGTCC 0: 1
1: 0
2: 3
3: 33
4: 351
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319159_907319161 -10 Left 907319159 1:53592048-53592070 CCATGGGAGGTCCAGGTCTGGGT No data
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319152_907319161 4 Left 907319152 1:53592034-53592056 CCCCAGGGCAAGGGCCATGGGAG No data
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319153_907319161 3 Left 907319153 1:53592035-53592057 CCCAGGGCAAGGGCCATGGGAGG No data
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319143_907319161 28 Left 907319143 1:53592010-53592032 CCACCCATCTCTGAGCATGAGTG 0: 1
1: 0
2: 0
3: 16
4: 227
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data
907319155_907319161 2 Left 907319155 1:53592036-53592058 CCAGGGCAAGGGCCATGGGAGGT No data
Right 907319161 1:53592061-53592083 AGGTCTGGGTCCCCAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907319161 Original CRISPR AGGTCTGGGTCCCCAGAACC AGG Intronic
No off target data available for this crispr