ID: 907319248

View in Genome Browser
Species Human (GRCh38)
Location 1:53592522-53592544
Sequence AGGGCTGCTGGGAGACAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 488}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907319248_907319259 15 Left 907319248 1:53592522-53592544 CCCAGCTGTCTCCCAGCAGCCCT 0: 1
1: 0
2: 0
3: 54
4: 488
Right 907319259 1:53592560-53592582 CTGTCTATTGGTCAACTCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 95
907319248_907319262 21 Left 907319248 1:53592522-53592544 CCCAGCTGTCTCCCAGCAGCCCT 0: 1
1: 0
2: 0
3: 54
4: 488
Right 907319262 1:53592566-53592588 ATTGGTCAACTCCTAGGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 81
907319248_907319257 3 Left 907319248 1:53592522-53592544 CCCAGCTGTCTCCCAGCAGCCCT 0: 1
1: 0
2: 0
3: 54
4: 488
Right 907319257 1:53592548-53592570 CTGGCCTGCGCGCTGTCTATTGG 0: 1
1: 0
2: 0
3: 5
4: 35
907319248_907319260 19 Left 907319248 1:53592522-53592544 CCCAGCTGTCTCCCAGCAGCCCT 0: 1
1: 0
2: 0
3: 54
4: 488
Right 907319260 1:53592564-53592586 CTATTGGTCAACTCCTAGGCAGG 0: 1
1: 0
2: 1
3: 3
4: 52
907319248_907319261 20 Left 907319248 1:53592522-53592544 CCCAGCTGTCTCCCAGCAGCCCT 0: 1
1: 0
2: 0
3: 54
4: 488
Right 907319261 1:53592565-53592587 TATTGGTCAACTCCTAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907319248 Original CRISPR AGGGCTGCTGGGAGACAGCT GGG (reversed) Intronic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900014572 1:139129-139151 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900044438 1:494331-494353 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065844 1:729237-729259 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900178156 1:1299715-1299737 AGGGCAGGTGGGAGACAGGCAGG + Intronic
900513848 1:3072228-3072250 AGGGCTGTTGTGAGCCAGGTGGG + Intronic
900713426 1:4129198-4129220 AGAGCTCGAGGGAGACAGCTTGG - Intergenic
900782438 1:4626801-4626823 CAGGCTGCTGGGATACAGCTGGG + Intergenic
901127236 1:6938311-6938333 AGGGCGGCTGAGAGACTGGTTGG + Intronic
901838155 1:11937393-11937415 AGGGCTGCTGGCTTACAGCAGGG + Intronic
901934077 1:12616251-12616273 AGGGCTGGCTGGAGACAGCCTGG + Intronic
902254556 1:15179328-15179350 TGGCCTGCTGAGGGACAGCTGGG - Intronic
902559009 1:17265398-17265420 AGGGCTGCAGGGATGCAGATAGG + Intronic
902812269 1:18895182-18895204 AGGGCTGCTCTGAGAAAGGTTGG - Intronic
902877418 1:19349293-19349315 AGGGCTGGGTGGAGTCAGCTCGG + Intronic
903278610 1:22237303-22237325 AGGGATGATGGGAGAGAGCCTGG + Intergenic
904385634 1:30140354-30140376 AGGGGTGCTGGGAGGAAGCTGGG + Intergenic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
905037222 1:34926154-34926176 AGAGCTGCGGGGAGGCTGCTTGG - Intronic
905357314 1:37393837-37393859 AGAGCTGTTGGGAGCCAGCGAGG + Intergenic
906057258 1:42927000-42927022 AGGGCTGCTGGGAGCAGGCCGGG + Exonic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907339118 1:53721365-53721387 AGGGCTGCTGGGAGAATGAAAGG + Intronic
909258617 1:73457590-73457612 AGTGCTACTTGGGGACAGCTAGG + Intergenic
912438623 1:109680810-109680832 AGAGCTGCTGGGGCAAAGCTAGG - Intronic
912441144 1:109699255-109699277 AGAGCTGCTGGGGCAAAGCTAGG - Intronic
912631587 1:111251140-111251162 AGAGCTGCTGGGTGTCAGCTGGG - Intergenic
916571796 1:166034409-166034431 AGGGCTGCAGGGAGGAAGCCTGG + Intergenic
918100000 1:181364921-181364943 AGGGCTGCTGGGAGAATGAGTGG + Intergenic
919797422 1:201329655-201329677 GGGGGTGCTGGCAGACAGCCTGG - Intronic
919915104 1:202134198-202134220 AGGGCTGCTGGGAGGGAGGCAGG + Exonic
919920305 1:202163285-202163307 CGGGATGCTGGGAGACCCCTGGG - Intergenic
920032737 1:203047197-203047219 GGGTCTGCTGGGACACAGCCAGG - Intronic
920455379 1:206097234-206097256 AGGGCTGCAGGGAGGCAGGAGGG - Intronic
920514738 1:206576366-206576388 AGGGATGGAGGTAGACAGCTAGG - Intronic
920650109 1:207831353-207831375 AGAGGTGATGGGAGCCAGCTTGG - Intergenic
921046471 1:211481353-211481375 AGGGCTCCTGGTGGACAGCCGGG + Exonic
922500581 1:226094433-226094455 AGGGCTCCTGAGAGGCAGCTTGG + Intergenic
922696392 1:227733142-227733164 AGCCCTGCTGGGAGACAGGAGGG - Intronic
922714288 1:227858828-227858850 AGGGGTGCTGGGGAACAGCCTGG - Intergenic
922733648 1:227968086-227968108 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734715 1:227972854-227972876 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924343894 1:243056703-243056725 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1063121357 10:3107025-3107047 AGGTGTGCTGGGTGACAGCAGGG - Intronic
1066732437 10:38448360-38448382 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1069737803 10:70669023-70669045 AGGGCTGCTGGTGGCCTGCTGGG + Intergenic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1070271755 10:74963476-74963498 AAGGCTGCTGTGATGCAGCTGGG + Intronic
1070527849 10:77310603-77310625 AAGGCTGCTCAGAGGCAGCTGGG - Intronic
1070647424 10:78211417-78211439 AGGCCTGCAGGGAGACAGAGAGG - Intergenic
1070779635 10:79130029-79130051 AGGGCTGCGGGGAGATGCCTAGG + Intronic
1071503542 10:86219617-86219639 AGGGCAGGAGGGAGAGAGCTGGG + Intronic
1072040416 10:91601203-91601225 AGGGCTGCTGGGGGAATGATGGG + Intergenic
1072761541 10:98060867-98060889 AGGACTGATGGGAGCCTGCTTGG + Intergenic
1072878718 10:99203280-99203302 AGGGCTGCAGGGAGCCATCTTGG - Intronic
1073042577 10:100617616-100617638 AGGGCTGCTGGGAGGGAGGAAGG - Intergenic
1073142565 10:101258521-101258543 ATGGCTGCTGGGGGACAGGAGGG + Intergenic
1074252261 10:111762808-111762830 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
1075114576 10:119615182-119615204 AGTGCTGCTGAGAGACAGACTGG - Intergenic
1075413989 10:122249183-122249205 AGGGCTGCTGGGAGGCCCCTGGG - Intronic
1075428857 10:122364127-122364149 AGGGCTGCTGGGGGTCGGCCAGG - Intergenic
1076253934 10:129005122-129005144 GGTTCTCCTGGGAGACAGCTGGG - Intergenic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1076876011 10:133215843-133215865 AGGGCTGCTGGCACCCAGCGTGG + Intronic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1076970768 11:130806-130828 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1077297962 11:1834847-1834869 GGGGCTGCTGGGAGGTGGCTGGG + Intronic
1077445442 11:2588521-2588543 AGGGCTGCTGGGGGTCACGTGGG - Intronic
1077453655 11:2665298-2665320 AGGGCTTCTGAGAGAAAGGTGGG + Intronic
1078526414 11:12104896-12104918 TGGGGTGCTGGGGGACAGCGAGG - Intronic
1078546893 11:12253301-12253323 AGGTCGGCTTGGAGACAGCGAGG - Intronic
1078749317 11:14144841-14144863 AAGGCTTCTGGGAGTCAGATTGG + Intronic
1079081581 11:17416959-17416981 AAGGCTGCTGGGACACAAATGGG + Exonic
1079506965 11:21163828-21163850 AGGGCCTTTGGGAGACAACTAGG - Intronic
1080520034 11:33060659-33060681 AGGGCTGCTGAAAGCCAGATGGG + Intronic
1080831080 11:35893962-35893984 AGGGGAGCAGGGAGGCAGCTGGG - Intergenic
1081321577 11:41698088-41698110 AGAGCTGCTGGAAGAAAGATGGG + Intergenic
1081552219 11:44124255-44124277 AGGGATGCTGTTAGACAGCCAGG + Intronic
1082261045 11:50076469-50076491 CAGGCTGCTGGGAGACAGGTAGG + Intergenic
1082261283 11:50077718-50077740 AAGGCTGCTGGGAGGCAGGTAGG + Intergenic
1083298131 11:61726174-61726196 AGGGCTGGTGGGAAGGAGCTGGG + Intronic
1083864353 11:65445690-65445712 AGGGCTTCTGGGAGAGGCCTGGG - Intergenic
1083897106 11:65625443-65625465 AGCGCAGCTTGGAGACAGCCCGG + Exonic
1084421578 11:69063176-69063198 AAGGCTGCTGGGAGGCTTCTGGG - Intronic
1085489787 11:76904529-76904551 AGGGTGGCTGGGTTACAGCTTGG - Intronic
1085707035 11:78795774-78795796 AGGGAGGCAGGGAGACAGCGTGG - Intronic
1087057681 11:93949582-93949604 AGGGCAGCAGAGAGACAGCAAGG + Intergenic
1088971212 11:114776087-114776109 GGATCTGCTAGGAGACAGCTTGG + Intergenic
1089208271 11:116782924-116782946 AGGGCTGCTGAAAGACATCCGGG - Exonic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089487830 11:118860863-118860885 AGGGCTGCTGCCAGGCAACTGGG - Intergenic
1089659151 11:119974616-119974638 TGGAGTCCTGGGAGACAGCTCGG - Intergenic
1090616093 11:128516636-128516658 AGGTCTGCAGGTAGACACCTGGG + Intronic
1090737624 11:129624113-129624135 AGGGAAGCTGGGAGACATCTTGG + Intergenic
1091798185 12:3309083-3309105 TGGGCTGGAGGGAGACAGTTGGG + Intergenic
1091977014 12:4833755-4833777 AAGGCTCATAGGAGACAGCTGGG - Intronic
1092166977 12:6348333-6348355 AGGGATGAAGGGAGACAGCTTGG - Intronic
1094626632 12:32130621-32130643 ATGGCTTCTGTGAGACTGCTGGG - Intronic
1094635438 12:32222755-32222777 AGGGCTGGAGGGAGCTAGCTAGG + Intronic
1095232391 12:39755496-39755518 AAAGCTGCTAGGAGACAGTTTGG + Exonic
1095331964 12:40977044-40977066 GAGGTTGCTGGGATACAGCTTGG + Intronic
1095826363 12:46533971-46533993 ATGGCTGCTGGGAAACAACTTGG - Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1097033589 12:56106939-56106961 AGGGCTCCCGGGAGACAGCAAGG + Intronic
1097182883 12:57180959-57180981 AGGGCTGCTGGGAGCCTACAAGG - Intronic
1097185098 12:57192511-57192533 AGGGCGCATGGGAGACACCTGGG - Intronic
1097929681 12:65169998-65170020 AGTGCTGCTGGGCTTCAGCTCGG + Exonic
1099689647 12:85936883-85936905 TGGCCAGCTGGGAGCCAGCTGGG - Intergenic
1100356779 12:93838457-93838479 AGGGGTACCGTGAGACAGCTGGG + Intronic
1100591579 12:96035167-96035189 AGGGGTGCTGTGAGAGATCTGGG + Intronic
1102028309 12:109726004-109726026 AGGGTTGCTGGGGGTCAGCCAGG + Intronic
1102904409 12:116663020-116663042 AGGGCACCTGGGAGAGAGCCAGG - Intergenic
1103009557 12:117447880-117447902 ATGGCTGCAGGCAGGCAGCTGGG - Intronic
1103196067 12:119044682-119044704 AGGGCTGCTGGGAGGAACCAGGG + Intronic
1103557620 12:121775772-121775794 AGGGCTGCTGGGAAGGAGCCCGG - Exonic
1103886940 12:124209349-124209371 AGGGCTGCTGGGAGCTGCCTGGG + Intronic
1103939833 12:124495662-124495684 AGGGGGGCTGGGAGCCATCTGGG - Intronic
1104054610 12:125219857-125219879 AAGGCTGCTGGGGGACCCCTGGG - Intronic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1104872789 12:132012451-132012473 AGGGCTGGAGGGAACCAGCTTGG - Intronic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1105815920 13:24036279-24036301 AGGGTTAATGGAAGACAGCTGGG + Intronic
1106235992 13:27860940-27860962 AGAGCTGCTGGGTTCCAGCTCGG - Intergenic
1106488848 13:30197392-30197414 AGGGCTTCTGGGAGACAGAAGGG + Intergenic
1106850703 13:33787536-33787558 AGGGCTGCAGGCAGACGGCCAGG - Intergenic
1107436161 13:40382466-40382488 CGGGCTGCTCGGAGACAACCTGG - Intergenic
1108426701 13:50309687-50309709 ACGTCTGCTGAGAGACAGCTGGG + Intronic
1108704890 13:52976039-52976061 AGGGTTGGTGGCAGGCAGCTGGG + Intergenic
1112610805 13:100952930-100952952 AGGGCAGCAGGAAGACTGCTGGG - Intergenic
1113343082 13:109446265-109446287 AGGGCTGGTGTTAGACAGCATGG - Intergenic
1113672774 13:112186161-112186183 AGGGCTGGAGGGAGCTAGCTTGG + Intergenic
1113802362 13:113093188-113093210 AGGGAGGCTGAGAGACAGCAAGG - Intronic
1113941203 13:114019414-114019436 AGGGCTCCTGGGTGACTGCGTGG - Intronic
1114040908 14:18677546-18677568 AATTCTGCTGGGTGACAGCTGGG - Intergenic
1114045945 14:18876033-18876055 AATTCTGCTGGGTGACAGCTGGG - Intergenic
1114118269 14:19643433-19643455 AATTCTGCTGGGTGACAGCTGGG + Intergenic
1114267573 14:21081840-21081862 AGGGCTGCTGGGGAGCAGCAAGG - Exonic
1116385941 14:44330001-44330023 TGGGCTGCTGGGTGGCAGCAAGG + Intergenic
1117026138 14:51622025-51622047 AAGGCTGCAGGAAGATAGCTTGG - Intronic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1118382588 14:65229688-65229710 AGGAGTGCAGGGAGACAGCAGGG + Intergenic
1118746381 14:68776435-68776457 CTGGATGCTGGGAGACAGCAAGG + Intergenic
1119980919 14:79080119-79080141 AGACTTCCTGGGAGACAGCTGGG + Intronic
1120790690 14:88578716-88578738 AGGGTTGCTGGGACACATATGGG - Intronic
1121619739 14:95337769-95337791 AGGGCTGCTAGCACAGAGCTGGG + Intergenic
1121657649 14:95609570-95609592 AGGGCCTCTTGGAGACAGTTGGG + Intergenic
1121842873 14:97149471-97149493 AGGGGTGCTGGGCAGCAGCTGGG - Intergenic
1122047404 14:99034044-99034066 AGGGCTCCTGGCAGCCAGCTGGG - Intergenic
1122406826 14:101505723-101505745 AGGGCTGTGGGTAAACAGCTTGG + Intergenic
1124015110 15:25867137-25867159 GGGGATGCTGGGAGACACCTGGG + Intergenic
1124589514 15:31040796-31040818 AGGGCTGGTGGGTGCCGGCTAGG + Intronic
1125592599 15:40864185-40864207 AGGTCTGCTGGGAGCCAGGGAGG + Intergenic
1125678704 15:41517080-41517102 AGGACTGCTGTGAGAGAGATGGG - Intergenic
1128740713 15:70082095-70082117 CTGGCTGCTGGGAGGCTGCTGGG - Intronic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129462632 15:75707568-75707590 AGGCCTGCTGTGAGGAAGCTGGG + Intronic
1129472332 15:75762650-75762672 AGGGTTGGTGGGAGGCAGCTGGG - Intergenic
1129496127 15:75982832-75982854 AGAGATGTGGGGAGACAGCTTGG - Intronic
1129526131 15:76215849-76215871 GGGGCTGCTTTGAGACAGCATGG - Exonic
1129722237 15:77883848-77883870 AGGCCTGCTGTGAGGAAGCTGGG - Intergenic
1130172641 15:81531553-81531575 AATGCTGCTGCGAGAGAGCTGGG - Intergenic
1130335061 15:82951572-82951594 AGGGCTGTTGGAAGAATGCTGGG + Intronic
1131195567 15:90352277-90352299 AGGGCTGTGGGGACACAGGTGGG - Exonic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1131742490 15:95409407-95409429 AGGGCAGCTGGGAGGCATTTTGG + Intergenic
1132204601 15:99977805-99977827 AGGGCTCCTGGGAGAAAGCAGGG - Intronic
1132581961 16:688876-688898 AGGCTGGCTGGGAGACCGCTGGG + Intronic
1132748592 16:1447148-1447170 GGGGGTGCAGGGAGCCAGCTTGG - Intronic
1132775144 16:1589354-1589376 AGGCCTGATGGGAGACAGCCTGG - Intronic
1133881897 16:9790100-9790122 AGGGTGCCTGGGAGACAGCAAGG + Intronic
1134091896 16:11395999-11396021 AGGGCTGCTGGGAGTAAGGAGGG + Intronic
1135422949 16:22316869-22316891 AGGGCTGCTGGGGGAGGGCGGGG + Intronic
1137696027 16:50462751-50462773 AGAGAGGCTGGGACACAGCTAGG - Intergenic
1137696296 16:50464385-50464407 TGAGCTGCTGTGAGACTGCTGGG - Intergenic
1137720486 16:50624880-50624902 ACAGCTGCAGGGAAACAGCTGGG + Intronic
1137724736 16:50649591-50649613 GGGACTGATGGGAGACAGCATGG - Intergenic
1138236857 16:55390847-55390869 AGGGTTGCAGGGAGAGAACTCGG - Intronic
1138340266 16:56284623-56284645 TGTGCTGCTGGGGGGCAGCTGGG - Intronic
1138418596 16:56885371-56885393 AGAGCTGCTGGGACCCACCTGGG + Intronic
1138445498 16:57060817-57060839 AGGGCTGCTGGGATACTTCCAGG - Intronic
1138606889 16:58095325-58095347 GGGGGTGGTGGCAGACAGCTGGG + Intergenic
1138667053 16:58579720-58579742 AGGGCTACAGGGAGAGAGCGCGG - Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1138916302 16:61468963-61468985 ATGGTTGCTGGTAGCCAGCTGGG + Intergenic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139422399 16:66856769-66856791 AGGTGTGCTGGGATCCAGCTGGG - Intronic
1139595962 16:67958462-67958484 AGGGCAGCAGGGAGACAGACTGG - Intronic
1139602940 16:67997838-67997860 AGGGTTGGTGGGAGACAGTAAGG + Intronic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141662351 16:85448256-85448278 AGGGATTCTGGGGTACAGCTGGG + Intergenic
1142214554 16:88824259-88824281 AGGGCTCGTGGGAGAAAGCCTGG + Intronic
1142288107 16:89179647-89179669 AGGTCTCCTGGGAGCCAGCGGGG + Intronic
1142449482 16:90166680-90166702 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142457610 17:65169-65191 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1142546665 17:708697-708719 AGGGCTGCTTGAAGGCACCTTGG - Intronic
1142679016 17:1534688-1534710 AGAGGTGCTGGGAGCCAGGTTGG - Intronic
1143179157 17:4973555-4973577 AGGGCAGCTGGGTGAGGGCTGGG - Intronic
1143484020 17:7243116-7243138 GGGCCGGCTGGGCGACAGCTGGG + Intronic
1144622904 17:16829886-16829908 AGAGGAGCAGGGAGACAGCTGGG + Intergenic
1144848329 17:18231476-18231498 AGGGCTGATGGTGGACAGCAGGG - Intronic
1144883527 17:18442830-18442852 AGAGGAGCAGGGAGACAGCTGGG - Intergenic
1145148701 17:20501556-20501578 AGAGGAGCAGGGAGACAGCTGGG + Intergenic
1145249498 17:21289505-21289527 AGGGCTGCTGGGCAGCAGCATGG + Intronic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146263375 17:31435878-31435900 AGGGATGCGTGGAGATAGCTGGG + Intronic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146496869 17:33330360-33330382 AGGACTGCAGGGAGGCTGCTGGG + Intronic
1147181690 17:38690534-38690556 AGAGCGGCTTGGAGACATCTGGG - Intergenic
1147247641 17:39132681-39132703 AGGGCTGAATGGAGGCAGCTGGG + Intronic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1147757697 17:42779798-42779820 AGTGCTGATGGAACACAGCTTGG + Intergenic
1147773211 17:42882099-42882121 AGGGATTCAGGGAGTCAGCTGGG + Intergenic
1147775587 17:42898520-42898542 AGGGCTGCTGGGCCATAGGTAGG - Intergenic
1147788085 17:42994634-42994656 AAGGCTGCAGGGAGACAGGCCGG + Intergenic
1147878798 17:43640925-43640947 AGGGCTGCTGGGTGAGGGCCTGG - Exonic
1147991148 17:44334319-44334341 AGGGCAGCAGGTAGACAGTTTGG - Intergenic
1148186906 17:45650865-45650887 GGGTCTGCTGGCTGACAGCTTGG + Intergenic
1149347562 17:55753563-55753585 AGGACTGGAGGCAGACAGCTGGG - Intronic
1149544734 17:57495057-57495079 TGGGCTGCAGGGAGAGGGCTTGG + Intronic
1150227598 17:63532256-63532278 AGGGCTGCTAGGACCCTGCTAGG - Intronic
1152057313 17:78040002-78040024 AGGGCTTCTGCAAGACAGGTAGG + Intronic
1152373294 17:79903970-79903992 AGGGCTGCTTGGAGATTACTTGG - Intergenic
1152386052 17:79975430-79975452 AAGGCTGCTGAGAGCCAGCCAGG + Intronic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1153324009 18:3799623-3799645 AGTATTGCGGGGAGACAGCTTGG - Intronic
1153781619 18:8500055-8500077 TGGCCTGCTGGGAGACAGGAAGG + Intergenic
1154204713 18:12326903-12326925 AGGGGTGCTGGGTGGGAGCTGGG + Intronic
1155912285 18:31517839-31517861 AGGGATGGTGGGAGTTAGCTGGG + Intronic
1156047550 18:32894131-32894153 AGGGCTGCTTGGAGAAACCTAGG + Intergenic
1158109089 18:53920029-53920051 GGTTCTGCTGGGAGTCAGCTGGG + Intergenic
1158955668 18:62535528-62535550 AGGGTGTCTGGGACACAGCTGGG + Intronic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160819614 19:1051982-1052004 AGAGCTGCTGGGAGACCGTGTGG + Exonic
1161099801 19:2415965-2415987 AGGGCAGCTGAGAGACAGGAGGG + Intronic
1161316615 19:3620352-3620374 AGGGCAGCTGGGTGAAGGCTGGG - Intronic
1161574805 19:5049374-5049396 ATGGCTCAGGGGAGACAGCTGGG + Intronic
1161610617 19:5240337-5240359 GGGGGTGCAGGGAGACAACTAGG + Intronic
1162963984 19:14147089-14147111 AGGGCTTCTGTGAGACAGCATGG + Intergenic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163654627 19:18538531-18538553 AGGGCAGAGGGGAGACAGATCGG - Intronic
1164912603 19:32025133-32025155 AGGGCTGCTGGAATACAGAGTGG - Intergenic
1166767856 19:45263138-45263160 CAGGCTGCTGGGATTCAGCTGGG - Exonic
1167321392 19:48799200-48799222 AGGGCAGGAAGGAGACAGCTGGG - Intronic
1167664859 19:50818119-50818141 ACGGCTCCTGGGAGATGGCTAGG - Intergenic
1167802543 19:51754102-51754124 AGGGCTCATGGGAAACAGGTAGG - Intronic
1168458118 19:56531025-56531047 AAGCCTGCTGGGAGAAACCTCGG + Intergenic
925112408 2:1347399-1347421 AGGGCTGGTGAGGGTCAGCTGGG - Intronic
925610491 2:5697146-5697168 AGGGAGGCTGGGAGGCCGCTCGG + Exonic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
925836714 2:7953437-7953459 AGCGCTGCTGGGGCCCAGCTGGG - Intergenic
927251686 2:21000411-21000433 AGAGCTCCAGGGAGACATCTGGG + Intergenic
927775361 2:25898771-25898793 AGAGGGGCTGGGAGACAGCTAGG + Intergenic
927908691 2:26881003-26881025 AGGGCTGCTGTAAGATTGCTAGG + Intronic
928368694 2:30723107-30723129 CAGGCTGTTGGGAGACAGCTTGG + Exonic
928793857 2:34992144-34992166 AGGGCTGGTGGGTGCCTGCTGGG + Intergenic
929865112 2:45710895-45710917 AGGGGTGCTGGGAGAGAGGGGGG + Intronic
930066591 2:47332476-47332498 ATGGCTGCTGGGAGACCTCCAGG + Intergenic
930554393 2:52876955-52876977 AGGGCAGCCAAGAGACAGCTTGG + Intergenic
931140584 2:59453208-59453230 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
931474162 2:62570960-62570982 AGGGCTGCTCAGGGACAGCAAGG - Intergenic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
932135767 2:69227317-69227339 GAGGCTTCTGGGAGCCAGCTGGG + Intronic
932320019 2:70815128-70815150 AGGGCAGCTGAGAGACAGAAGGG - Intronic
932408184 2:71528211-71528233 AGGACTGCCTGGAGACAGATGGG + Intronic
932466643 2:71928430-71928452 TGGGCAGCTGGCAAACAGCTGGG - Intergenic
932589869 2:73058945-73058967 AGGGAGGCTGGGAGAGGGCTGGG - Intronic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
932734101 2:74242215-74242237 AGGGCTGGTGGGACAGAGCCTGG + Intronic
933909526 2:86927632-86927654 AAGGCTTCTGGGAGACATCATGG + Intronic
934023199 2:87975747-87975769 AAGGCTTCTGGGAGACATCATGG - Intergenic
935817880 2:106864209-106864231 AGGGCTGCAGGGAGAGAGGTTGG - Intronic
936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG + Intronic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937984993 2:127634409-127634431 AGGGCTGCTGGGACAGAGGTAGG + Intronic
937992554 2:127672679-127672701 AGGGCTGCTGGGAAGGAGATGGG - Intronic
938262297 2:129904739-129904761 AGGGAGGCTGGGACACAGCCTGG - Intergenic
938269279 2:129954975-129954997 AATTCTGCTGGGTGACAGCTGGG + Intergenic
940702949 2:157069333-157069355 AGGTCTGATGGGAGAGAGGTTGG - Intergenic
942605104 2:177682332-177682354 AAGGCGGCTGGGCTACAGCTTGG - Intronic
942849060 2:180461392-180461414 AGGAGAGCTTGGAGACAGCTTGG + Intergenic
945929731 2:215842797-215842819 ATGGAAGCTGGGAGACAGTTTGG - Intergenic
946216480 2:218187617-218187639 TGGGCAGATGGGAGACAGGTGGG + Intergenic
946334817 2:219029645-219029667 AGTGCTGCAGGGACACAGCAGGG + Exonic
947186022 2:227456382-227456404 AGGGGTGCTGGGGGACAGGGTGG + Intergenic
947670902 2:231934750-231934772 AGGACTGCTGGGACTCACCTGGG + Intergenic
947711924 2:232321419-232321441 ATGGCCCCTGGGTGACAGCTGGG - Intronic
947838715 2:233193785-233193807 AGGGAAAGTGGGAGACAGCTGGG - Intronic
947858102 2:233338167-233338189 GGGGGCGCTGGGACACAGCTGGG + Intronic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
948171136 2:235904259-235904281 AGGGTTGCAGGGGGACAGCGAGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948923900 2:241081850-241081872 AGGACTGCTGGGCCACAGCTGGG + Intronic
948982275 2:241500509-241500531 AGGCCTGCTGGGAGATGGCTGGG - Intronic
949009711 2:241671576-241671598 TGGGCTGCTGGGCGCAAGCTTGG - Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168892101 20:1301243-1301265 GGGGCTCCTGGGAGACACCTGGG - Intronic
1169268255 20:4180786-4180808 TGGGCAGCTGAGAGACAGCCAGG - Intronic
1169673993 20:8133330-8133352 AGGGCTGCGGGGACACATCTGGG + Intronic
1169758711 20:9068694-9068716 GGGGCTGCGAGGCGACAGCTCGG + Intergenic
1170547921 20:17450743-17450765 AGGGCTCCAGGGAAATAGCTAGG - Intronic
1171360500 20:24583421-24583443 TGGGCAGCTGGCAGAGAGCTAGG + Intronic
1172105897 20:32517232-32517254 AGGGCTGCTGGGAGAATGCCTGG - Intronic
1172843015 20:37913436-37913458 AGGGCTGCAGGGAGAGAGAAAGG - Intronic
1174010068 20:47442467-47442489 AGAGCTGCTGGCAGCCATCTTGG - Intergenic
1176116342 20:63433124-63433146 AGGGCAGGTGGCAGCCAGCTGGG - Intronic
1178675014 21:34623425-34623447 AGCGCTGCTGAAAGTCAGCTTGG + Intergenic
1178775352 21:35544943-35544965 AGGGCTGTTGGCAGTCATCTGGG - Intronic
1179457179 21:41507876-41507898 CGGGGTGCTGGGAGAGTGCTGGG - Intronic
1179474428 21:41634238-41634260 AGGGCTGCTAAGAGACAGGCCGG - Intergenic
1179957731 21:44750554-44750576 AGGGGTGCGGGGACACAGCCAGG - Intergenic
1180180594 21:46117175-46117197 AGGGCCTCTGGGAGGCAGCCAGG + Intronic
1180211140 21:46296031-46296053 AGGGTTGCTGTGAGACCCCTGGG - Intronic
1180464476 22:15598654-15598676 AATTCTGCTGGGTGACAGCTGGG - Intergenic
1180911999 22:19457292-19457314 GAGGGGGCTGGGAGACAGCTGGG - Intronic
1181146253 22:20849985-20850007 AGGGCTGCAGGGTAACAGCAAGG + Intronic
1182470893 22:30547566-30547588 GGGACTTCTGGGAGACAGCAGGG + Intergenic
1182691360 22:32165732-32165754 AGGTTTGATGGGAAACAGCTGGG + Intergenic
1183104976 22:35609202-35609224 GTGTCTGCTGGGAGACCGCTGGG + Intronic
1183661771 22:39225499-39225521 GGGCATGCTGGGACACAGCTGGG + Intronic
1184331908 22:43832859-43832881 AGGTCTGCTGGGAGACAGACAGG - Intronic
1184457368 22:44618766-44618788 AGGGCTCCTGGGCGGGAGCTGGG + Intergenic
1184479562 22:44738599-44738621 GGCTCTGCTGGGAGACAGCCTGG - Intronic
1184857521 22:47154554-47154576 AGGGCTTCAGGGAGCCAGCCTGG - Intronic
1185061979 22:48611875-48611897 AGGGCTGCTGAGAGTCAGGAGGG + Intronic
1185231785 22:49687893-49687915 AGGGCTGGTGGGAGACGGTTGGG - Intergenic
1185269677 22:49923252-49923274 AGCGCTGCAGGGAGGCGGCTCGG - Exonic
1185275234 22:49947808-49947830 AGTGCTGCCGGGAGACAGGGTGG + Intergenic
1185366403 22:50438892-50438914 AGGACGGCTGGGAAATAGCTGGG - Intronic
1185382945 22:50518504-50518526 TGGGCTGGGGGGAGACAGCAGGG - Intronic
950437530 3:12989557-12989579 AGGGGTGCTTGAAGGCAGCTGGG - Intronic
950530078 3:13548298-13548320 TGGGCTGCAGGGAGACCCCTGGG + Intergenic
950664671 3:14488053-14488075 AGGGCTGCTGGGAGGAAGGAGGG - Exonic
951538414 3:23760633-23760655 AGAGCTGCTGGGGGAGGGCTTGG - Intergenic
953732964 3:45465609-45465631 AGGCCTGCTGAGAGCCAGCCAGG - Intronic
953913426 3:46904146-46904168 AGGGCTGCTGGCAGATCCCTCGG + Intergenic
954399970 3:50314312-50314334 AGGGCGGTTGGGGCACAGCTTGG - Intergenic
954439604 3:50514629-50514651 AGAGCTGCTGGGAGGCCACTGGG + Intergenic
955049987 3:55400992-55401014 GGGACTGCTGGGAAGCAGCTTGG - Intergenic
955326167 3:58010432-58010454 AGGGCTGCTGGAGATCAGCTGGG - Intronic
956682894 3:71797875-71797897 AGGCCTCTTGGGAGACAGCCAGG + Intergenic
956749090 3:72332068-72332090 AGGGACCCTGGGAGACAGTTGGG - Intergenic
957215761 3:77317741-77317763 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215765 3:77317752-77317774 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957215790 3:77317810-77317832 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215794 3:77317821-77317843 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957215804 3:77317843-77317865 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215815 3:77317866-77317888 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215819 3:77317877-77317899 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957999028 3:87728266-87728288 AAGGCAGTTGGGCGACAGCTTGG - Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
960944655 3:122957885-122957907 AGGGCTGCTTGGAGAGCACTTGG - Intronic
961064268 3:123861279-123861301 AGCTCTGCAGCGAGACAGCTGGG + Intronic
961152907 3:124654693-124654715 TGGGCTGCTGGGAAAGAGCATGG + Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961825722 3:129598071-129598093 TGGGCTGCGGGGAGCCAGCAGGG - Intronic
962682306 3:137813123-137813145 AGGGCTGCTGGGGCACCCCTAGG + Intergenic
966200621 3:177357185-177357207 AATGCTGCTGAGAGACAGCAAGG + Intergenic
967392659 3:188972537-188972559 TCGGCTGCCGGGAGACTGCTGGG - Intronic
967942341 3:194775914-194775936 ATGGCTCCTGAGAGCCAGCTGGG - Intergenic
967968913 3:194985074-194985096 AGGCCTGCAGGGAGACCTCTGGG + Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968521585 4:1036829-1036851 AGGGCTGAGCGGGGACAGCTGGG + Intergenic
969624915 4:8297521-8297543 AGGGGTGCTGGGAGGAGGCTGGG + Intronic
970477703 4:16440445-16440467 AGCTGTGCTGTGAGACAGCTCGG - Intergenic
970830906 4:20338692-20338714 TGTACTGCTGGGAGACAGCAGGG + Intronic
971013556 4:22464788-22464810 GGGACTGCTGGGAGCCAGCAAGG - Intronic
971018870 4:22515317-22515339 AGTGGAGCTGGGAGGCAGCTCGG + Intronic
972914679 4:43860965-43860987 AGGGCTGGTGGGAACTAGCTAGG + Intergenic
973719806 4:53711746-53711768 ACAGCTGCTGGGAGCCAGTTAGG - Intronic
975465455 4:74704280-74704302 AGAGCTGCTGGGACACTGCAAGG - Intergenic
979057659 4:116016374-116016396 AGGGCTGCAGTGACACAGGTTGG - Intergenic
979526347 4:121721420-121721442 AGGGCTGTAGGGAGACAGCAAGG + Intergenic
979969546 4:127116819-127116841 AGGGCTACTGCTAGACAACTTGG - Intergenic
982148888 4:152429583-152429605 AGCCATGCTGGAAGACAGCTTGG + Intronic
982605112 4:157505962-157505984 AGGGCTTTTGGGAAGCAGCTAGG - Intergenic
982663415 4:158231717-158231739 AGGGGGGTTGGTAGACAGCTTGG + Intronic
983918132 4:173314351-173314373 AAGGCTGCCAGGAGACAGCATGG - Intronic
984453427 4:179933822-179933844 AGGACTTCGGGGAGCCAGCTGGG + Intergenic
985551239 5:534608-534630 CTGGCTGCTGGGACACTGCTGGG + Intergenic
985979866 5:3453545-3453567 AGAGGTGGTGAGAGACAGCTTGG - Intergenic
985996918 5:3602231-3602253 CGGGCAGCGGGGAGGCAGCTGGG + Intergenic
986173800 5:5334760-5334782 AGTGCGGCTGGGAGGGAGCTGGG - Intergenic
987699663 5:21380680-21380702 ATGGCTGCCTGGAGACAGCATGG + Intergenic
987989654 5:25193832-25193854 AGGGCAGCTGAGAGGCAGTTTGG - Intergenic
988752747 5:34207378-34207400 ATGGCTGCCTGGAGACAGCATGG - Intergenic
988959903 5:36359338-36359360 AGGGCGCCTGGGAGGCAGTTTGG - Intergenic
989565538 5:42897902-42897924 TGGGATGCTGGGAGTCAGGTGGG - Intergenic
991740520 5:69668192-69668214 ATGGCTGCCTGGAGACAGCATGG - Intergenic
991756980 5:69884975-69884997 ATGGCTGCCTGGAGACAGCATGG + Intergenic
991792095 5:70247933-70247955 ATGGCTGCCTGGAGACAGCATGG - Intergenic
991819980 5:70544297-70544319 ATGGCTGCCTGGAGACAGCATGG - Intergenic
991836383 5:70760857-70760879 ATGGCTGCCTGGAGACAGCATGG + Intergenic
991884541 5:71248259-71248281 ATGGCTGCCTGGAGACAGCATGG - Intergenic
993311333 5:86337368-86337390 TGGGCTGAAGGGAGAAAGCTAGG + Intergenic
995105157 5:108369275-108369297 AGGGCTACTGGGTTATAGCTAGG - Intronic
996907251 5:128615310-128615332 TGGGGTCCTGGGAGACAGCAAGG - Intronic
997141663 5:131387797-131387819 AAGGCTGCCTGGAGACAGCAAGG - Intronic
997844995 5:137278197-137278219 AGGGCTGCAAGGTGGCAGCTAGG - Intronic
998397293 5:141826828-141826850 AGGCCGGCTGGGAGGGAGCTAGG + Intergenic
998630619 5:143893922-143893944 AGCTTGGCTGGGAGACAGCTGGG + Intergenic
999441017 5:151600879-151600901 AGGGCTGTAGGGAAATAGCTAGG + Intergenic
1001596860 5:172904053-172904075 AGGGCTGCTGGATGACTGCCAGG - Intronic
1001734648 5:173988760-173988782 GGGGCTGGAGGGAGAAAGCTGGG - Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002604230 5:180372290-180372312 AGGGCTGCTTTGAGCCTGCTGGG + Intergenic
1002729405 5:181324598-181324620 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1003145782 6:3509275-3509297 AGGGCTGGAGGGAGCAAGCTGGG + Intergenic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004942762 6:20578320-20578342 AGGGTTGATGGGAGAGAGGTAGG - Intronic
1005471187 6:26164211-26164233 AGGTCTGCTGGGAGACTGAGAGG - Intronic
1005550912 6:26914155-26914177 ATGGCTGCCTGGAGACAGCATGG - Intergenic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006374352 6:33663637-33663659 TGGGCTGGAGGGAGACAGATGGG + Intronic
1006437327 6:34032847-34032869 TGGGCTGCTGGCAGGCAGCCAGG + Intronic
1006601920 6:35231912-35231934 GGGGCTGCTGAGGGACAGCTGGG - Intronic
1006903289 6:37516618-37516640 AGTGTGGCTGGGAGTCAGCTAGG + Intergenic
1007380599 6:41488070-41488092 AGGGATTATGGGAGACAGCATGG + Intergenic
1011262886 6:85486991-85487013 AGGCCTGCTGAGGTACAGCTGGG - Intronic
1012509902 6:99991272-99991294 AGGGAAGCTGGGAGACAGATGGG + Intronic
1013299026 6:108785982-108786004 AGGGCTGCTGAAAGATATCTGGG - Intergenic
1013300229 6:108798355-108798377 AGGGCTGCGAGGAGGCAGCATGG - Intergenic
1013586162 6:111581007-111581029 AGGGCTGCTTGAAGAGGGCTGGG + Intronic
1013830364 6:114265327-114265349 AAGGCTACTGGCAGAAAGCTGGG + Intronic
1014286507 6:119504659-119504681 AGTGCTGCTGAGAGCCAGGTAGG - Intergenic
1015698818 6:136012109-136012131 AGGGGTGCTGAGAGACAGGAGGG - Intronic
1017420712 6:154269373-154269395 AGGTGGGATGGGAGACAGCTAGG + Intronic
1018739555 6:166717044-166717066 TGGGCTGCTGGGACACATGTGGG + Intronic
1018945687 6:168345794-168345816 GGGACAGCTGGGGGACAGCTGGG + Intergenic
1018945741 6:168345910-168345932 GGGGCAGCCGGGGGACAGCTGGG + Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019408773 7:897684-897706 AGGGGTGCTGGGGGGCACCTCGG + Intergenic
1019552352 7:1609309-1609331 GGGGCAGTGGGGAGACAGCTTGG + Intergenic
1019794740 7:3041343-3041365 AGGGCAGCAGGGAGTGAGCTTGG - Intronic
1021272630 7:18609970-18609992 ATGGCTGCTGGAAGACAGTGTGG + Intronic
1022104305 7:27187624-27187646 TGGGCTGCAGAGAGAGAGCTTGG - Intergenic
1022572100 7:31464869-31464891 AGGGCTGGGGGCAGAGAGCTGGG + Intergenic
1023615332 7:42013922-42013944 AGGGCTGCTGGCTGAGTGCTGGG - Intronic
1024027377 7:45424194-45424216 AGGGCTGCATGGTGACTGCTTGG - Intergenic
1024073730 7:45808035-45808057 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024649604 7:51392165-51392187 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025053685 7:55747495-55747517 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025131788 7:56377969-56377991 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025171906 7:56766561-56766583 TGGCTTGATGGGAGACAGCTGGG + Intergenic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025182584 7:56831048-56831070 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1025689342 7:63745926-63745948 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1025695640 7:63772950-63772972 AGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1025699957 7:63808994-63809016 TGGCTTGATGGGAGACAGCTGGG - Intergenic
1026000983 7:66558622-66558644 AGGGGTCCTGGCAGACAGCACGG + Intergenic
1026534395 7:71228175-71228197 GGGGCTGTTTAGAGACAGCTGGG - Intronic
1026534625 7:71229622-71229644 GGGGCTGTTTGGAGACTGCTGGG - Intronic
1028119111 7:87037230-87037252 AGTGCAGCTGAGAGACAACTTGG - Intronic
1028603494 7:92629055-92629077 AGGGCTGGTGGGAAAGAGCACGG + Intronic
1029491095 7:100870499-100870521 AGGGAGGCTGGGAGACAGAGGGG + Intronic
1030780794 7:113597212-113597234 AGGGCTGCTTGTTGACAGCTGGG - Intergenic
1031134036 7:117866421-117866443 AGGGCTGCTGGGGGATATGTTGG + Intronic
1032051129 7:128651734-128651756 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1032051533 7:128653488-128653510 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032442152 7:131950139-131950161 AGCGCTGCAGTGAGACAGCAAGG - Intergenic
1034432083 7:151046088-151046110 AGGGCCGGTGGAAGACAGCCAGG - Intronic
1035221266 7:157407809-157407831 CAGGCAGCTGGGAAACAGCTTGG + Intronic
1035725932 8:1824646-1824668 TGGGGTGCGGGGGGACAGCTGGG - Intronic
1036080642 8:5551972-5551994 AGGGCACCTAGGAGATAGCTAGG - Intergenic
1036186834 8:6629566-6629588 AGGCTTCCTGGGAGACTGCTCGG - Intronic
1036285859 8:7443639-7443661 AGGGCTGCAGGGAGAGAGAAGGG - Intronic
1036335614 8:7867890-7867912 AGGGCTGCAGGGAGAGAGAAGGG + Intronic
1036539034 8:9685572-9685594 AAGGCAGCTGGGACAGAGCTTGG - Intronic
1037323046 8:17661858-17661880 TGTGCTGCTGGGGAACAGCTGGG + Intronic
1037446990 8:18975082-18975104 AGGCCTGCTGGGTGGCAGGTGGG + Intronic
1037913759 8:22759535-22759557 AGGGCTGCGGGGCTGCAGCTGGG + Intronic
1038490139 8:27964972-27964994 CGGGCTGCTTGGTGAGAGCTTGG - Intronic
1039576384 8:38627212-38627234 AGTTTTGCTGGGAGAGAGCTGGG + Intergenic
1041187707 8:55318135-55318157 AGGGTTACTGGGAGACAGGCAGG + Intronic
1042060869 8:64815969-64815991 AGGGCCGCTGTGGGTCAGCTGGG + Intergenic
1042764713 8:72308564-72308586 AGGGTTGGGGGGAAACAGCTGGG + Intergenic
1044357617 8:91242528-91242550 AGGGCCTCTGGGAGGCAGTTAGG + Intronic
1045565603 8:103311347-103311369 AGGGATGCAGGGATACAGCCTGG - Intronic
1046997792 8:120543603-120543625 AGGGATGTGGGGAGAGAGCTGGG + Intronic
1048393303 8:133988532-133988554 AGGGCTGCAAGGAGCTAGCTAGG - Intergenic
1048989764 8:139754432-139754454 GGTGCTGCTTGCAGACAGCTGGG + Intronic
1049214901 8:141403031-141403053 AGGGCTGCTGGGAGGCTGGACGG - Intronic
1049243405 8:141549929-141549951 AGGACTCCTTGGGGACAGCTGGG - Intergenic
1049531508 8:143157858-143157880 AGGGTTCCTGGCAGAGAGCTGGG - Intergenic
1049612684 8:143562724-143562746 CGGGCTCCTGGGGAACAGCTGGG + Exonic
1049666601 8:143846718-143846740 AGGGGTGATGGATGACAGCTGGG - Intergenic
1049927137 9:420382-420404 AGGGCTGAAGGGAGGCAGATTGG - Exonic
1050016492 9:1239463-1239485 TGGGAGGCTGGGAGGCAGCTGGG - Intergenic
1053137179 9:35658495-35658517 AGGGCTGCTGGAGGAGGGCTGGG + Intronic
1054744827 9:68843797-68843819 AGGGTTGCTTGGAAACAGGTTGG - Intronic
1055436198 9:76294736-76294758 AGGGCAGCTGGGAGAAGGCTGGG - Intronic
1056826366 9:89878977-89878999 GGAGCAGCTGGGAGCCAGCTGGG + Intergenic
1057495193 9:95554927-95554949 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
1057917292 9:99066438-99066460 AGGGCTGCAGGCAGATAGCTGGG + Intronic
1058327343 9:103715274-103715296 AGGGCAACTCTGAGACAGCTGGG - Intergenic
1059418876 9:114178790-114178812 AGAGAGGCTGGGGGACAGCTTGG + Intronic
1059427673 9:114231257-114231279 AGGGGTGCTAGGAGGAAGCTGGG + Intronic
1060155551 9:121317712-121317734 AGGGCCTCTGGGAAACATCTGGG - Intronic
1060423818 9:123488251-123488273 AGGGAGGCTCGGAGGCAGCTGGG - Intronic
1061013253 9:127967656-127967678 AGGCCTGCTGGGAGACTGGTGGG - Intronic
1061322865 9:129842433-129842455 TGGGGTGCTGGGAAACAGCCAGG - Intronic
1061326755 9:129868934-129868956 AGGGGGGCTGCTAGACAGCTTGG - Exonic
1061592016 9:131603802-131603824 CAGGCTGCTGGGAGCCAGCTCGG - Intronic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1062190117 9:135243667-135243689 TGGGCTGCTAGGAGACAGGGTGG - Intergenic
1062372902 9:136249305-136249327 ACTGGTGCTGGGAGCCAGCTCGG - Intergenic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203577377 Un_KI270745v1:19867-19889 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1185446776 X:262081-262103 AGGACAGCTTGGAGACAGCTTGG + Intergenic
1185611993 X:1398508-1398530 TTGGCTGCTGGGAGTGAGCTGGG - Intergenic
1185629899 X:1508199-1508221 AGAGCTGCAGGCAGTCAGCTGGG + Intronic
1188585393 X:31768321-31768343 AGGGATGGTGGGAGACAGGAGGG - Intronic
1189622454 X:42856657-42856679 AGTGCTACTGTGAGACATCTTGG - Intergenic
1191177218 X:57517017-57517039 AGGGCTCCTGGGAAGCACCTTGG + Intergenic
1193334039 X:80266240-80266262 TGGGCTGCTGGGACACTGATGGG + Intergenic
1195660494 X:107373158-107373180 AGGCTTGCTGTGAGACAGATTGG + Intergenic
1196882217 X:120208679-120208701 AGGGCTGTTGGGGCTCAGCTCGG + Intergenic
1197251356 X:124219100-124219122 AGGGACCCTGGGAGATAGCTCGG + Intronic
1197758383 X:130011791-130011813 AGTGGTGCTGGGAGACTGATGGG + Intronic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1200076816 X:153555274-153555296 AGGGCAGCCGGGAGACACCAGGG - Intronic
1201793966 Y:17874671-17874693 AGGGATGCTGGGAGACACATTGG - Intergenic
1201807588 Y:18031314-18031336 AGGGATGCTGGGAGACACATTGG + Intergenic
1202355349 Y:24042486-24042508 AGGGATTCTGGGAGACACATTGG - Intergenic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1202515429 Y:25627623-25627645 AGGGATTCTGGGAGACACATTGG + Intergenic