ID: 907321051

View in Genome Browser
Species Human (GRCh38)
Location 1:53602563-53602585
Sequence AGGAAGGCAGGCCCTAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907321044_907321051 9 Left 907321044 1:53602531-53602553 CCCTCCTGCACTTAGGAGGCTGT No data
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310
907321045_907321051 8 Left 907321045 1:53602532-53602554 CCTCCTGCACTTAGGAGGCTGTG 0: 1
1: 0
2: 1
3: 21
4: 263
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310
907321039_907321051 25 Left 907321039 1:53602515-53602537 CCTTGGGTTACTCCTCCCCTCCT No data
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310
907321041_907321051 13 Left 907321041 1:53602527-53602549 CCTCCCCTCCTGCACTTAGGAGG 0: 1
1: 0
2: 3
3: 17
4: 201
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310
907321043_907321051 10 Left 907321043 1:53602530-53602552 CCCCTCCTGCACTTAGGAGGCTG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310
907321046_907321051 5 Left 907321046 1:53602535-53602557 CCTGCACTTAGGAGGCTGTGTGC 0: 1
1: 0
2: 2
3: 17
4: 221
Right 907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG 0: 1
1: 1
2: 2
3: 31
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907321051 Original CRISPR AGGAAGGCAGGCCCTAGAAA GGG Intronic
901386663 1:8913969-8913991 AGGAAGGCAGGACCTGGCAGAGG + Intergenic
901895759 1:12310759-12310781 AGGAAGGAAGGAGCAAGAAATGG - Intronic
903557519 1:24204393-24204415 AGGAAGGCAGGCCTCAGAGGGGG - Intergenic
903884897 1:26535429-26535451 AGGAAGGCCTGCTCTAGAACAGG - Intronic
904103421 1:28054236-28054258 AGGAAAGCAGGACCTAGAGAGGG + Intronic
904196353 1:28788661-28788683 AGGAGGGCAGGGCCTGGAACTGG - Intergenic
904471390 1:30738738-30738760 AGGAAGGCAGGTTCGAGAAAAGG - Intronic
904888761 1:33762056-33762078 AGAAAGCCAAGCCCTAGAAAAGG + Intronic
905669657 1:39783216-39783238 AGGAGGGTAGGCCCTGGAAGTGG - Intronic
906253174 1:44327214-44327236 ACTAAGGAAGGGCCTAGAAATGG + Intronic
907321051 1:53602563-53602585 AGGAAGGCAGGCCCTAGAAAGGG + Intronic
908858478 1:68455696-68455718 AGGAAGGGAGGCCCAAGCAAAGG - Intergenic
910302925 1:85727865-85727887 GGGAGGGCAGGCCCTGGAGATGG - Intergenic
912458054 1:109812087-109812109 ATGAATGCAGGGCCTAGAAGAGG - Intergenic
912485623 1:110025322-110025344 AGCAAGGAAGGCCTTAAAAAAGG + Intergenic
913045399 1:115069563-115069585 AGGAAAGCAGGGCCAAGAGATGG + Intronic
913165924 1:116184471-116184493 AGTAAGACAGGCACCAGAAAGGG + Intergenic
913229286 1:116728423-116728445 AGGATGGAAAGCCCTAGAAGAGG - Intergenic
913644523 1:120844140-120844162 AGGTAGGCTGGCCCTTGACATGG + Intergenic
914636550 1:149558297-149558319 AGGTAGGCTGGCCCTTGACATGG + Intergenic
915346204 1:155198281-155198303 AGGAATGCAGGCCCAACAGATGG - Intronic
915453209 1:156021036-156021058 AGGCAGGCGGGCACTACAAAGGG - Intergenic
915924286 1:160004343-160004365 AGGACTGCCGGCCCTTGAAAAGG - Intergenic
915930729 1:160059311-160059333 AGGAAGCCAAGGCCTAGAAGAGG + Intronic
919248519 1:195020567-195020589 AACAAGGTAGGCCCTGGAAATGG + Intergenic
920088227 1:203433431-203433453 ATGAAGGCAGGACTCAGAAATGG + Intergenic
920363707 1:205436900-205436922 AGGAAGGCACGCATTATAAAGGG - Intronic
921159739 1:212464429-212464451 AGGAAGGCAGGTGCTACACATGG - Intergenic
921297173 1:213715107-213715129 AGTAAGGCAGGACTGAGAAAGGG + Intergenic
921646170 1:217620825-217620847 AGGAAAACTGGCTCTAGAAAAGG - Intronic
922363473 1:224843565-224843587 AGGGAAACAGGCCCTTGAAAAGG + Intergenic
923498748 1:234546984-234547006 AGGAAGGGAGGGCCAAGGAAAGG + Intergenic
923862305 1:237903980-237904002 AGGAAGGCAGGCTATTGGAATGG - Intergenic
1062844506 10:693508-693530 AGTAAAGCAAGACCTAGAAACGG - Intergenic
1063022003 10:2138034-2138056 AGGAAGGCTGGCACTTGAGAAGG - Intergenic
1064163581 10:12966915-12966937 AGGAAGGCAGGGTGTGGAAATGG + Intronic
1065118658 10:22506840-22506862 GGGAATGCAGGCTCTAGAGATGG + Intergenic
1066178921 10:32940688-32940710 AGTAAGGTAAGGCCTAGAAAGGG - Intronic
1067280645 10:44869483-44869505 AGGAAGGAAGGAGGTAGAAAGGG + Intergenic
1068040301 10:51815848-51815870 GGGAAAGCAGCCCCTGGAAAGGG + Intronic
1068705706 10:60073028-60073050 AAAAAGGCACGCCCTAAAAATGG - Exonic
1070766160 10:79057646-79057668 AGGAAGGCGGGCCCAAGGGATGG - Intergenic
1070920630 10:80183371-80183393 AGGAAGGAAGGACCTCAAAAAGG - Intronic
1071961184 10:90810026-90810048 AGGGAAACAGGCCCTTGAAAAGG - Intronic
1072011212 10:91304599-91304621 AGGGAAACAGGCCCTTGAAAAGG + Intergenic
1072615589 10:97047205-97047227 AGGAAGGCTGGGCCTAGTACTGG + Intronic
1075538677 10:123294243-123294265 AGGAAGGAAGGCCAGAGACAGGG + Intergenic
1075697439 10:124447457-124447479 AGGTAGGAAGGCCCAAGGAACGG + Exonic
1077411288 11:2405081-2405103 AGCAAGGCAGGCCCAGGAAGGGG + Intronic
1078087904 11:8245233-8245255 AGCAAGGCAGGGCCCAGACATGG - Intronic
1078631405 11:13007978-13008000 AGGAAGGCTTTCCCTAGAAGAGG - Intergenic
1080751016 11:35150350-35150372 AGCAAGGCAGGCCTGAGAGATGG + Intronic
1081773659 11:45664381-45664403 AGGAAGGCAGTCCTGTGAAAGGG + Intronic
1083016865 11:59463073-59463095 AGGAATGCAGACCAAAGAAAAGG + Intergenic
1083698861 11:64461059-64461081 GGGAAGGCAAGTCCTAGGAAGGG + Intergenic
1084079646 11:66813010-66813032 AGGAAGGCATGCCCCTGAAATGG - Intronic
1087093696 11:94300277-94300299 AGGAAGGAAGGCAGGAGAAAGGG + Intergenic
1087173360 11:95073674-95073696 GGGAAGTGAGGCCCTAGAATTGG - Intergenic
1087761764 11:102110485-102110507 AGGAAGGAAGGAACAAGAAAAGG + Exonic
1088804848 11:113342881-113342903 AGGAAGGCAGGACTTGGCAATGG + Intronic
1088818411 11:113436974-113436996 AGGATCCCAGGCCATAGAAAGGG - Intronic
1089311281 11:117559887-117559909 AGGAAGGAAGGGCCTAGAGTTGG + Intronic
1089593498 11:119560100-119560122 AGGAAGGGAGGCCTCAGGAAGGG - Intergenic
1089880512 11:121768897-121768919 CTGAAGGCATGCCCTTGAAAAGG - Intergenic
1091588053 12:1827277-1827299 GGGGGGGCAGACCCTAGAAAGGG + Intronic
1091599545 12:1909538-1909560 AGGCAGGCAGGGCCTGGAAAAGG - Intronic
1092104937 12:5914644-5914666 AGAAAGCCAGCCCCTAGTAAGGG + Intronic
1092489138 12:8929388-8929410 AGGAAGGCAGGCTGTGGATAAGG - Intronic
1092845907 12:12585027-12585049 AGGAAGTAAGGACCTAGAAATGG + Intergenic
1093066057 12:14659495-14659517 AGGAAGGCATGGCCTTGAGAAGG - Intronic
1093358502 12:18197555-18197577 AGGGAAACAGGCCCTTGAAAAGG - Intronic
1094052590 12:26237697-26237719 AGGAAGGCAGGGCCCAGAATGGG + Intronic
1094629928 12:32163742-32163764 AGGAAGGCAGGAAATAGAAAGGG - Intronic
1096194056 12:49637602-49637624 AGGAAGCCAGGCCAGAGAAGGGG - Exonic
1096851731 12:54443386-54443408 AGTAAAGCAAGCCCTAGAAATGG + Intergenic
1099836028 12:87910502-87910524 AGGGAAACAGGCCCTTGAAAAGG + Intergenic
1101734762 12:107454657-107454679 GGGAAGGCAGGCCCTCGAGTGGG + Intronic
1102774146 12:115504411-115504433 AGGAAGGAAGGCCCCAGCTAGGG - Intergenic
1103911843 12:124356253-124356275 AGGACTGCAGGACCTAGAACAGG + Intronic
1104746022 12:131211019-131211041 AGAAAGGCAGCCCCTAGGCATGG - Intergenic
1105029731 12:132874321-132874343 GGGAAGCCAGGCCCTGGAACAGG + Intronic
1105029745 12:132874374-132874396 AGGAAGCCAGGCCCTGGAACAGG + Intronic
1105029845 12:132874692-132874714 AGGAAGCCAGGCCCCGGAACAGG + Intronic
1105029864 12:132874745-132874767 GGGAAGCCAGGCCCTGGAACAGG + Intronic
1105029881 12:132874798-132874820 GGGAAGCCAGGCCCTGGAACAGG + Intronic
1105214195 13:18274752-18274774 AGAAAGGCAGGGCCCAGAGAGGG + Intergenic
1105984648 13:25553439-25553461 AAGAAGACAGGCCTTTGAAATGG - Intronic
1106043849 13:26118998-26119020 AGGAACTCAGGCGCTAGAGAAGG + Intergenic
1106078755 13:26483501-26483523 AAGCAGGCAGGCCCTGGACATGG - Intergenic
1108918212 13:55642469-55642491 AGAAAGGCAGACCCAAGAAGGGG - Intergenic
1110025018 13:70526154-70526176 AGGAAGAATGGCCCTAAAAATGG - Intergenic
1110158132 13:72342795-72342817 AGGAAGGCAGCCAGTAGAATTGG - Intergenic
1110880922 13:80571399-80571421 AGGAAGGCAGGCCATTGGGAAGG + Intergenic
1113285329 13:108840364-108840386 TGGAAGGCAGGGCATAGAGATGG + Intronic
1113309487 13:109116849-109116871 AGGAAGGCAGACACTTGCAATGG + Intronic
1113885258 13:113655432-113655454 AGGAAGGGAAGCCCTGGAGATGG + Intronic
1113918032 13:113886182-113886204 AGGAAGGCAGGACCTTGAAGAGG + Intergenic
1113919014 13:113895510-113895532 AGGAGGGCAGGACAAAGAAAAGG - Intergenic
1114422279 14:22594358-22594380 AGGAAGTCAGCCCCGGGAAAGGG + Intergenic
1117436950 14:55724732-55724754 AAGAAGGCAGGCACTAGCATTGG - Intergenic
1118160705 14:63287089-63287111 AGGAAGGCATGTCCTGTAAATGG - Intronic
1119029161 14:71177976-71177998 AGGTAGGGATGGCCTAGAAAGGG - Intergenic
1119436251 14:74599723-74599745 AGGAGGGCAGGCCCGGGAGATGG + Intronic
1119667256 14:76493845-76493867 AGGAGGGTAGGCCCTGCAAAGGG - Intronic
1122500798 14:102198055-102198077 AAGAGAGCAGGCCCAAGAAAGGG + Intronic
1124413697 15:29457475-29457497 AGGAAGGCAGGCCCTGGCCCTGG + Intronic
1126711340 15:51460289-51460311 AGGAAGGCAGTCACCTGAAAAGG - Intronic
1126851867 15:52801932-52801954 AGGAAGTCTGGGCCTAGAGAAGG - Intergenic
1127599879 15:60524638-60524660 AGGCAGTCAGGCCCTGGAAAAGG - Intronic
1128088971 15:64906100-64906122 AGAAAGTCACGCCCTAGAATTGG + Intronic
1129714701 15:77840305-77840327 TGGAAGGCAGAGCCTGGAAAGGG - Intergenic
1130676383 15:85955862-85955884 AGGAAACCAAGACCTAGAAAGGG + Intergenic
1130698386 15:86154440-86154462 TGGACGGAAGGCCCTAGAATTGG + Exonic
1132120650 15:99172422-99172444 ATGAAGGCAGCCCAGAGAAAAGG - Intronic
1132776413 16:1597289-1597311 AGGCGGGCAATCCCTAGAAAGGG - Intronic
1132861227 16:2072749-2072771 GGGAACGCAGGCCCAGGAAAGGG - Intronic
1133280939 16:4664952-4664974 AGGAGGGCAGGTCCCAGAACAGG + Intronic
1134034687 16:11020734-11020756 AAGAGGGCAGGCCCTATAGATGG - Intronic
1134343945 16:13371957-13371979 AGAAAGGCAGGCAAGAGAAATGG - Intergenic
1134766619 16:16764300-16764322 GGCAAGGCAAGACCTAGAAATGG - Intergenic
1135020875 16:18961951-18961973 AGGAAGGCGTGACCCAGAAAAGG - Intergenic
1137661508 16:50210715-50210737 AGGAAAGCAGGCCCCAGCAGAGG - Intronic
1137692918 16:50441676-50441698 AGGCAGACAGGCCGCAGAAAGGG + Intergenic
1138347339 16:56328139-56328161 TGGAATGCAGTCCCTAGAACTGG - Intronic
1139155378 16:64435080-64435102 AGAAAGGCAGGCCCTTAAGATGG + Intergenic
1140374227 16:74431847-74431869 AGGACGGCTGGCCACAGAAAAGG + Intergenic
1141848299 16:86626341-86626363 AGCAAGCCAGGCCCGAGGAATGG - Intergenic
1142236315 16:88924228-88924250 AGGAAGGCGGGGCCCAGAGAGGG - Intronic
1142684373 17:1569312-1569334 AGTAAGCCAGGTGCTAGAAACGG + Intronic
1142698814 17:1647663-1647685 AGGTCAGCAGGCCCTAGAAGCGG + Intronic
1142878586 17:2867387-2867409 AGGAAGGCACAGCCTAGAGACGG - Intronic
1144249822 17:13404652-13404674 AGGAAGGCAGGAGCCAGAAGTGG + Intergenic
1144420560 17:15094179-15094201 ATGAAAGCAGACCCAAGAAATGG + Intergenic
1144949344 17:18985586-18985608 GGGAAGGCAGGCCCTCGACAGGG + Intronic
1147533066 17:41298483-41298505 AGGACGGCAGGCCATCGACAGGG + Intergenic
1147606320 17:41775752-41775774 AGGAAGACGGGCCCTGGAGAGGG + Intronic
1149272697 17:54998528-54998550 AGCAAGCCAGGCCTTAGCAAAGG + Intronic
1150709172 17:67515287-67515309 AGGAAGGCATGCCCAATAGAAGG + Intronic
1151651815 17:75474954-75474976 AGGGAGGCAGGGCCCAGAGAGGG + Intronic
1151685658 17:75644969-75644991 AGGAAGGCCGGCCAAGGAAAAGG - Intronic
1151716945 17:75835819-75835841 TGGAGGGCATGCCCTAGAGACGG + Intronic
1152299593 17:79487261-79487283 AGGATGGCAGGCCCTGGGCAAGG + Intronic
1152720919 17:81923477-81923499 AGGAAGGCAGGCGCAAGACAAGG + Intronic
1155388478 18:25307539-25307561 AGGAAGGCAGGGTCTGGAAATGG - Intronic
1157173038 18:45425551-45425573 GGGATGGCAAGCCCTAGAGATGG + Intronic
1158515081 18:58124097-58124119 CGGAAGGCAGGCGCTGGAGAGGG - Intronic
1159284968 18:66336976-66336998 AGGAAGCTAGGGCCTAGAATGGG + Intergenic
1160905727 19:1450869-1450891 GGGATGGCAGGACTTAGAAAAGG + Intronic
1165426277 19:35747306-35747328 AGGATAACAGCCCCTAGAAATGG - Exonic
1166050533 19:40256377-40256399 AGGAAGGAAGGCGGCAGAAAGGG + Intronic
1166645862 19:44531188-44531210 AGGAAAGTAGTCCCTAGAGAGGG - Intergenic
1167732220 19:51266774-51266796 AGGAAGTCAGGCCAGAGAGACGG + Intronic
925185793 2:1845514-1845536 AAGAAGGCAGGCGCTAAAGAGGG - Intronic
925716816 2:6791705-6791727 TGGAAGGGAGGCCCTAGAAAGGG + Intergenic
926156453 2:10456846-10456868 AAGAGGGCAGGCCCTGGAGACGG + Intergenic
927576879 2:24207834-24207856 TGGATGGCAGGCCCTAGAGGAGG + Intronic
927708653 2:25312158-25312180 AGCAAGCCAGGCCCAAGAAGGGG + Intronic
927893074 2:26764489-26764511 AGGAGGGCAGGGCCAAGAAGGGG - Intronic
927961575 2:27243509-27243531 AGGAAGCCAGGCCCTAGAAACGG - Exonic
928341686 2:30447944-30447966 AGAAAGGTAGGCCCTAGCCAGGG + Intronic
930195503 2:48505938-48505960 AGGAAAGCAGGGCTTAGCAAGGG + Intronic
931982984 2:67714079-67714101 AGGAAGACAGGCAGTAGCAAAGG - Intergenic
933219971 2:79677252-79677274 AGGAAGGCAGGGACTTTAAAGGG - Intronic
934300124 2:91771998-91772020 AGAAAGGCAGGGCCCAGAGAGGG - Intergenic
934602678 2:95669913-95669935 GGGAATGCAGAGCCTAGAAAAGG - Intergenic
936536050 2:113312105-113312127 GGGAATGCAGAGCCTAGAAAAGG - Intergenic
937124114 2:119462353-119462375 AGGAAACCAAGGCCTAGAAAGGG + Intronic
937978439 2:127596333-127596355 AGGAGGGCAGGCCAGAGAAGGGG - Intronic
938071800 2:128312309-128312331 AGGAAGTCAGGCCCCAGAGAAGG - Intronic
938623503 2:133082942-133082964 AGGAATGCTGGCCCTAGAGTGGG - Intronic
940369475 2:152884384-152884406 AGAAAGACAAGACCTAGAAAGGG - Intergenic
940521457 2:154755480-154755502 AGGAATGCATGCCATAAAAAAGG + Intronic
941431303 2:165417537-165417559 GGGAAGGCAGCCAGTAGAAATGG - Intergenic
941752158 2:169144677-169144699 AGGAAGCCATGCCCTAGAAAAGG + Intronic
942604750 2:177678850-177678872 AGAGAGGCAAGCCCAAGAAAAGG + Intronic
943244453 2:185428450-185428472 AGGAGGGAATGCTCTAGAAATGG - Intergenic
943564081 2:189496854-189496876 AGGAAGCCAGGGGCTAGGAAAGG - Intergenic
943743977 2:191441826-191441848 AGGACGGCAGGCCCTTCCAATGG - Intergenic
943765380 2:191655205-191655227 TGGAAGGCAGGAGCTAGAGATGG + Intergenic
944650203 2:201822000-201822022 AGGAAAGCAGAGACTAGAAAAGG - Intronic
945801483 2:214437048-214437070 AGGAATGCAGTCACTACAAAAGG - Intronic
946542339 2:220698567-220698589 AGGATAACAGGCCCTGGAAAGGG + Intergenic
947330805 2:229027522-229027544 TGTAAGGCAGGCCGTGGAAAGGG + Intronic
947488467 2:230573779-230573801 AGAAAGGCAGGCCCGGGAAGAGG - Intergenic
947909140 2:233790319-233790341 AGTAAGGCAGGCAATAAAAAAGG - Intronic
948465902 2:238151489-238151511 GGGAAGGCAGGCCCCGGAGATGG + Exonic
1169951050 20:11043555-11043577 TGGAAGCCTGGCCCAAGAAATGG - Intergenic
1170168427 20:13384843-13384865 AGGAACGCTGGCCCAAGACAAGG - Intergenic
1170448624 20:16457737-16457759 AGTAAGGCCTGCCCTAGATAAGG + Intronic
1170601236 20:17843194-17843216 AGGAGGGCAGGCCATAGGGAAGG - Intergenic
1172645555 20:36467071-36467093 AGGAAGGCAGGGCCGAGAGAAGG - Intronic
1173860149 20:46277902-46277924 AGGAAGGCAGGGCCGAGGGAGGG + Intronic
1174095693 20:48087947-48087969 AGGAAGGCAGGGCTGAGAGATGG - Intergenic
1176277924 20:64284772-64284794 AGGAGGGGAGCTCCTAGAAAAGG + Intronic
1176965610 21:15208626-15208648 AGGAAGCAAGGCCATAGAAAGGG + Intergenic
1179508503 21:41857317-41857339 AGGAAGGGATGACCTGGAAATGG + Exonic
1180102331 21:45594763-45594785 AGGAACGCAGACCCGGGAAAGGG - Intergenic
1180975951 22:19848568-19848590 AGGAAGGTAGGGCCTTGAAGTGG - Exonic
1181555899 22:23671525-23671547 AGAAAGGCAGGGCCCAGAGAGGG + Intergenic
1181571643 22:23771171-23771193 AGGAAGCCTGGGCCAAGAAAGGG - Intronic
1181698478 22:24607128-24607150 AGAAAGGCAGGGCCCAGAGAGGG - Intronic
1182003325 22:26939083-26939105 AGGCAGGCAGGGTCTAGGAATGG - Intergenic
1182529148 22:30941852-30941874 AGGGAGGGAGGCCCTGGAACTGG - Intronic
1182922895 22:34096587-34096609 AGCAAGGCAGTAACTAGAAATGG - Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183802457 22:40178561-40178583 GGGAGGGCAAGCCCTAGAACGGG + Intronic
1184158954 22:42686710-42686732 GGGCAGGCAGCCCCTAGAATGGG + Intergenic
949197558 3:1331189-1331211 AAGAAAGAATGCCCTAGAAAGGG - Intronic
950268884 3:11597176-11597198 AGGCAGGCAGGCAGGAGAAAGGG + Intronic
951262832 3:20532118-20532140 TGAATGGCAGGCCCTAGGAAGGG - Intergenic
951391758 3:22113313-22113335 AGGAAAGCAGGCTTTAGGAAAGG + Intronic
951466075 3:23001522-23001544 AGGAAATCAGGCCCAAGAAGAGG + Intergenic
952161276 3:30695766-30695788 AGGAAGTCAGGCAATAGAAATGG - Intergenic
952830051 3:37557179-37557201 AAGAAAGCAGACCCAAGAAAAGG - Intronic
953232532 3:41077548-41077570 AGGAAGGCAGGGTCTTTAAAGGG + Intergenic
953827629 3:46267871-46267893 AGAAAGGCAGGATTTAGAAAGGG + Intergenic
955550967 3:60085035-60085057 AGGGAGCCAGTCCCTAGAAGTGG - Intronic
956133436 3:66075690-66075712 AGGAAAGCAGGACCCAGAGATGG + Intergenic
956639844 3:71405224-71405246 AGGATGGCAGGCATCAGAAAAGG - Intronic
956753962 3:72367462-72367484 AGGATGGCTGGCCCTGGAATGGG + Intergenic
957317994 3:78592710-78592732 AGGAAGGCAGGCCAAAGTACAGG + Intergenic
957700113 3:83699391-83699413 AGGAAGGCAGAAAGTAGAAAGGG + Intergenic
958798271 3:98729782-98729804 TAGAAGGCAGGCCCTACAATGGG + Intergenic
958962652 3:100524662-100524684 AGGAAAGCATGCCCTGGAAATGG - Intronic
961044395 3:123698861-123698883 GGGAAGGCAGGCACGATAAAAGG + Intronic
961527258 3:127513113-127513135 AGGCAGGTAAGCCCTAGAATTGG - Intergenic
962927658 3:140010418-140010440 AGGCAGGCCAGCCCTAGAAATGG - Intronic
962951610 3:140224953-140224975 AGGAAGGGCAGCCATAGAAAAGG + Intronic
963431378 3:145209172-145209194 ATGAAGGCAGTCTCTAAAAAAGG + Intergenic
963926696 3:150958496-150958518 AGGAAGGCAGGAACCAGAACAGG - Intronic
964245063 3:154642226-154642248 AGGAAGGCTGGGCCAAGGAAAGG - Intergenic
964515728 3:157505702-157505724 TGGAAGGCTGACCATAGAAATGG - Intronic
966419309 3:179721703-179721725 TAGAAGGCAGGCCAGAGAAAAGG - Intronic
966424557 3:179767119-179767141 AGGAAGGCAGTCCAGAGAAATGG - Intronic
966986479 3:185184599-185184621 AGCAAGGCAGTCCCTAAAGAAGG + Intergenic
968578044 4:1377008-1377030 AGGCAGCCCGGCCCTTGAAATGG - Intronic
968714436 4:2144841-2144863 GGGAAGGCAATCCCTAGCAACGG + Intronic
970077502 4:12241082-12241104 AGGAAGAATGGACCTAGAAAAGG - Intergenic
970446103 4:16124460-16124482 TAAAAGGCAGGCCCAAGAAAAGG + Intergenic
973207326 4:47575289-47575311 AGGAGGGCAGGCCACAGGAAAGG - Intronic
974083988 4:57240114-57240136 GGGAAGGCAGGCACTGTAAAGGG - Intergenic
974353036 4:60774122-60774144 TGGGAGACAGGGCCTAGAAAGGG + Intergenic
976269835 4:83219720-83219742 AGGAAGGCAGGATCTGGAATGGG - Intergenic
978264974 4:106812771-106812793 AGGCTGGCCAGCCCTAGAAATGG - Intergenic
979478343 4:121184569-121184591 AGGTAGTCAGGCCTTAGAAGGGG - Intronic
981130934 4:141157612-141157634 AGGAGATCAGGCCCAAGAAAAGG - Intronic
981259067 4:142697823-142697845 AGTAAGTCATGGCCTAGAAAGGG - Intronic
981535746 4:145797604-145797626 ATGAATGCAGGAACTAGAAAGGG - Intronic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
984242792 4:177237418-177237440 TGAAAAGCAGGGCCTAGAAATGG + Intergenic
985691799 5:1317170-1317192 AGGAAGCCAGGCCCATGAGAGGG + Intergenic
986902709 5:12456425-12456447 AGGAAGGTAGTTCTTAGAAATGG - Intergenic
987122959 5:14784838-14784860 AGCAAGTGAGGCCCTAGAAAAGG + Intronic
990601269 5:57360788-57360810 AAGAAGGCAGACTCTAGAAGGGG + Intergenic
991129213 5:63102654-63102676 ATGAAGGCTGTGCCTAGAAAAGG + Intergenic
991264708 5:64703865-64703887 GGGAAGGCAGGGCATTGAAAAGG + Intronic
994219697 5:97181533-97181555 GGGAAGAGAGGCCCAAGAAAGGG + Intronic
994413383 5:99437948-99437970 AGGAAGCCAGGGCCGAGGAAAGG + Intergenic
996577971 5:124997668-124997690 AGGAAGGGAGGCCAAAGAAAAGG - Intergenic
996818402 5:127598304-127598326 GGGAAGGAAGGCCCCAGGAATGG + Intergenic
1001095967 5:168775744-168775766 AGGAAGGCTGACCCTGGAAGGGG - Intronic
1001325209 5:170718992-170719014 AGGAAGGCCAGCTCTATAAAGGG + Intronic
1002075995 5:176708865-176708887 AGGAAGCCAGGCCTCAGAAGAGG - Intergenic
1002785264 6:395099-395121 AGGCAGGCAGGCAATACAAAAGG - Intronic
1003336443 6:5177425-5177447 AGGCAGGCAGTGCCTAGGAAGGG - Intronic
1005917514 6:30366054-30366076 AGGAGGACAGGCACTAGAGATGG - Intergenic
1006088814 6:31615890-31615912 AGAGAGGCAGGCCCGGGAAAGGG - Intronic
1006134532 6:31887804-31887826 AGGCCGGGAGGCCCTGGAAAAGG - Exonic
1007062373 6:38953498-38953520 AGTAAGGTAGGACCAAGAAACGG - Intronic
1007687353 6:43674843-43674865 AGGACAGAAGGCCTTAGAAATGG - Intronic
1008965860 6:57311991-57312013 AGAAAGGGAGACCGTAGAAAGGG + Intergenic
1012388995 6:98715786-98715808 AGGAAAGCATCCTCTAGAAAGGG + Intergenic
1012924929 6:105258233-105258255 AGGAAGACATGTCCTGGAAAAGG - Intergenic
1014252968 6:119133601-119133623 AGGTAGGCTGCCCCAAGAAATGG + Intronic
1014736909 6:125104384-125104406 AGGAGGACAGCCCCAAGAAATGG + Intergenic
1015646355 6:135393222-135393244 AGGTAGGAAGGCCTTTGAAATGG - Intronic
1016292386 6:142539325-142539347 ATGAAGGCAGGACTAAGAAAGGG - Intergenic
1017327576 6:153157599-153157621 AGGAAGGAAAGCCCAAGAGAGGG + Intergenic
1017899426 6:158706272-158706294 AAGAAGGCAGCCCCTAGATCAGG - Intronic
1017941779 6:159059776-159059798 AGGAAGACTGGCCCAAAAAAAGG - Intergenic
1019838605 7:3416334-3416356 AGGAGGGAGGGCCCTAGAACGGG - Intronic
1019930760 7:4221367-4221389 AGGGTGGCAGGCCCCACAAACGG + Intronic
1020810959 7:12849259-12849281 AGGATAGCAGGCCTTGGAAAAGG + Intergenic
1021024541 7:15648511-15648533 AGGATAGCAGGCCGGAGAAAGGG + Intronic
1021270318 7:18576898-18576920 AGGAAGCAAAGCCCTAGGAATGG + Intronic
1022149781 7:27590100-27590122 AAAAAGTCAGGCCCTAAAAATGG + Intronic
1022268644 7:28784446-28784468 AGGGAGGGAGCCCCGAGAAAGGG - Intronic
1022667051 7:32421295-32421317 AGGAAGGCAGGGAAGAGAAAGGG - Intergenic
1023090135 7:36609572-36609594 AGGAAGGCGTGCCCTAGCAGAGG - Intronic
1024162710 7:46694681-46694703 AGGAAGGGATGCACCAGAAATGG + Intronic
1024436108 7:49356596-49356618 AGGAAAGCATGGCCTATAAAAGG - Intergenic
1026034960 7:66824283-66824305 AGGCTGGCAGGCCCTCAAAAGGG - Intergenic
1028314163 7:89379092-89379114 AGAAATACAGGCTCTAGAAAAGG - Intergenic
1028668984 7:93379181-93379203 AGTAATGCAGGCCCAAGAACAGG + Intergenic
1029299097 7:99564448-99564470 AGGAAGGTAGGACCTTGAAGAGG - Intronic
1030654340 7:112149849-112149871 CCAAAGGCAGCCCCTAGAAAAGG + Intronic
1031922658 7:127613189-127613211 AGGATGTCAGGCCCAAGGAAGGG - Intronic
1032334123 7:131008842-131008864 AGGAAGTCACTCTCTAGAAAGGG + Intergenic
1032364244 7:131284659-131284681 GGGAAGGCAGCACTTAGAAAGGG - Intronic
1034099023 7:148435974-148435996 TGGGAGGCAGGCCCTGGGAAGGG - Intergenic
1034299148 7:149999844-149999866 AGCAAGGCTGGCTCAAGAAATGG - Intergenic
1034418138 7:150975876-150975898 AGGAAAACAGACCCAAGAAAGGG + Intronic
1034806867 7:154096929-154096951 AGCAAGGCTGGCTCAAGAAATGG + Intronic
1035724956 8:1818464-1818486 AGGCAGGCAGGCCGTGGGAAGGG + Intergenic
1035862004 8:3039260-3039282 AGGAAGGAAGGGTCAAGAAATGG - Intronic
1036561365 8:9902864-9902886 AGGAGGGCAGGCGGTAGGAAGGG - Intergenic
1039719125 8:40143602-40143624 TGGGAGGCAGGCCCCAGTAAGGG - Intergenic
1039895856 8:41715922-41715944 AGCAAGGCAGGGCCCAGAGAGGG + Intronic
1040525249 8:48217252-48217274 AGGAATGAAGGGTCTAGAAATGG + Intergenic
1042081083 8:65051633-65051655 AGGAATGAAGGCCTTAGGAAAGG + Intergenic
1042747333 8:72121684-72121706 AAGACTGCAGGCCTTAGAAATGG - Intergenic
1045375189 8:101565583-101565605 AGGAAGGGAGGCCATGGAGATGG + Intronic
1045809938 8:106209639-106209661 AGGAAGGCAAGCCATAGTCAAGG + Intergenic
1046443315 8:114284587-114284609 AGGGAAACAGGCCCTTGAAAAGG - Intergenic
1047097473 8:121640220-121640242 AGGAGGGGAGGCCCGGGAAAGGG + Intronic
1049955000 9:684673-684695 AAGAAGGCAAACCCTGGAAAAGG - Intronic
1050747369 9:8892020-8892042 AGGAAGGGAGGGAGTAGAAAGGG - Intronic
1051409262 9:16771937-16771959 AGGATGGCAGGGACTATAAATGG + Intronic
1051818316 9:21135140-21135162 AGGAGAGGAGGCCCAAGAAAAGG + Intergenic
1052641040 9:31166175-31166197 AGGAAGTCATGCCCTTGAAAGGG + Intergenic
1056513968 9:87332957-87332979 AGCAAGAGAGACCCTAGAAAGGG - Intergenic
1056676267 9:88679286-88679308 TGGAATGCAGGCCCTAGAGCAGG + Intergenic
1058602100 9:106681418-106681440 AGGAAGGCTGGCTCTAGAGAAGG - Intergenic
1060596313 9:124851204-124851226 AGGAAGGGAGGGACTAGAAAAGG - Intergenic
1060882002 9:127123838-127123860 AGGATGGCAGGCACCAGGAAGGG + Intronic
1061512989 9:131072145-131072167 AGGGAGGGAGGACCTGGAAATGG + Intronic
1061593179 9:131612037-131612059 AGGAAGGAAGGCCCTCGATAGGG + Intronic
1061885901 9:133591021-133591043 AGGCAGGCAGGCTCTGGATAGGG + Intergenic
1185794045 X:2949632-2949654 AGAAAGGCATTCCGTAGAAATGG + Exonic
1187298562 X:18026438-18026460 AGGCAGGCAGGCCAGAGGAAAGG + Intergenic
1187717067 X:22113392-22113414 AGGAAGGGAGGCCCTGAGAATGG - Intronic
1189052953 X:37665603-37665625 AGGAAGGCACTCTCTAAAAAGGG - Intronic
1189217896 X:39343042-39343064 GGAAAGGCAGTCCCTGGAAATGG - Intergenic
1189242855 X:39539165-39539187 AGGCAGGTAGGGACTAGAAAGGG + Intergenic
1189543875 X:42021543-42021565 AGAAAGACAGCCCCAAGAAAGGG - Intergenic
1189629430 X:42936087-42936109 AGGAAGGCCAGCACTAGTAAGGG - Intergenic
1189779661 X:44502039-44502061 AGGAGGGCAGGGGCTAGAAATGG - Intergenic
1190370865 X:49739499-49739521 AGGAAGGCTGGCCTTGGAATGGG + Intergenic
1194642346 X:96417502-96417524 AGGTAGGCAGGCCATACCAAGGG - Intergenic
1195860749 X:109380461-109380483 AGGAAGTAAGGCCCAAGGAAAGG - Intronic
1195967250 X:110439818-110439840 AGGAAAGCAGGGCCTAGGGAAGG - Intronic
1195985094 X:110621256-110621278 AGGAAGCCACACCCTAGGAAAGG - Intergenic
1196463102 X:115949372-115949394 AGGAAGGCAGGAGCTAAGAAAGG + Intergenic
1199473602 X:148221972-148221994 GGGAAGGCAGGACATAGAAGAGG + Intergenic
1200116245 X:153770955-153770977 AGGCAGGCAGGCCCTGGGGAAGG - Exonic