ID: 907321576

View in Genome Browser
Species Human (GRCh38)
Location 1:53606083-53606105
Sequence AGAATCCCAGCTCCAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 677}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907321567_907321576 18 Left 907321567 1:53606042-53606064 CCCTTCTGAGCCTCAGTTTCTTC No data
Right 907321576 1:53606083-53606105 AGAATCCCAGCTCCAGGGGATGG 0: 1
1: 0
2: 2
3: 50
4: 677
907321569_907321576 8 Left 907321569 1:53606052-53606074 CCTCAGTTTCTTCATCTATAAAA 0: 78
1: 961
2: 4203
3: 10589
4: 18902
Right 907321576 1:53606083-53606105 AGAATCCCAGCTCCAGGGGATGG 0: 1
1: 0
2: 2
3: 50
4: 677
907321566_907321576 23 Left 907321566 1:53606037-53606059 CCTCACCCTTCTGAGCCTCAGTT 0: 2
1: 2
2: 78
3: 360
4: 1326
Right 907321576 1:53606083-53606105 AGAATCCCAGCTCCAGGGGATGG 0: 1
1: 0
2: 2
3: 50
4: 677
907321568_907321576 17 Left 907321568 1:53606043-53606065 CCTTCTGAGCCTCAGTTTCTTCA No data
Right 907321576 1:53606083-53606105 AGAATCCCAGCTCCAGGGGATGG 0: 1
1: 0
2: 2
3: 50
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907321576 Original CRISPR AGAATCCCAGCTCCAGGGGA TGG Intronic