ID: 907322935

View in Genome Browser
Species Human (GRCh38)
Location 1:53617006-53617028
Sequence TGCATGAAGCCCCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907322935_907322947 19 Left 907322935 1:53617006-53617028 CCCACCCCATGGGGCTTCATGCA 0: 1
1: 0
2: 2
3: 12
4: 135
Right 907322947 1:53617048-53617070 AGAGGGCCTAGAGCCAGCCTAGG 0: 1
1: 0
2: 0
3: 23
4: 267
907322935_907322942 2 Left 907322935 1:53617006-53617028 CCCACCCCATGGGGCTTCATGCA 0: 1
1: 0
2: 2
3: 12
4: 135
Right 907322942 1:53617031-53617053 CCTCTCTGCCCTCCTCCAGAGGG 0: 1
1: 1
2: 6
3: 49
4: 404
907322935_907322940 1 Left 907322935 1:53617006-53617028 CCCACCCCATGGGGCTTCATGCA 0: 1
1: 0
2: 2
3: 12
4: 135
Right 907322940 1:53617030-53617052 TCCTCTCTGCCCTCCTCCAGAGG 0: 1
1: 0
2: 4
3: 53
4: 559
907322935_907322950 30 Left 907322935 1:53617006-53617028 CCCACCCCATGGGGCTTCATGCA 0: 1
1: 0
2: 2
3: 12
4: 135
Right 907322950 1:53617059-53617081 AGCCAGCCTAGGCCCTAGGCTGG 0: 1
1: 0
2: 3
3: 64
4: 224
907322935_907322949 26 Left 907322935 1:53617006-53617028 CCCACCCCATGGGGCTTCATGCA 0: 1
1: 0
2: 2
3: 12
4: 135
Right 907322949 1:53617055-53617077 CTAGAGCCAGCCTAGGCCCTAGG 0: 1
1: 0
2: 1
3: 12
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907322935 Original CRISPR TGCATGAAGCCCCATGGGGT GGG (reversed) Intronic
900206356 1:1433496-1433518 GGCCTGGGGCCCCATGGGGTGGG - Intergenic
900885233 1:5410400-5410422 TGGAGGAAGCCACATGGGCTGGG + Intergenic
901664656 1:10819497-10819519 TGGTAGAAGCCCCATTGGGTGGG + Intergenic
903070504 1:20724723-20724745 TGCATGCAGCCCCTTGGCTTCGG + Intronic
903370013 1:22829396-22829418 TGCCTGCAGCCTGATGGGGTCGG + Intronic
905995789 1:42380224-42380246 AGCCTGAAGCCCCACGGGGGTGG - Intergenic
906265067 1:44422395-44422417 TGAATGAAGCCCCACCAGGTTGG - Intronic
907322935 1:53617006-53617028 TGCATGAAGCCCCATGGGGTGGG - Intronic
910746897 1:90583871-90583893 GGGAAGGAGCCCCATGGGGTAGG - Intergenic
911159592 1:94671383-94671405 TGCAAGAAGATCCATGTGGTGGG + Intergenic
911552872 1:99305918-99305940 TCCACGGAGCCCCATGGGGAAGG + Exonic
916320844 1:163502091-163502113 TGAATGAAGCCACATTGAGTGGG - Intergenic
922560408 1:226565319-226565341 TTCATGAAGACCCTGGGGGTGGG + Intronic
924109986 1:240689453-240689475 TGCATGAATCCCCCTGAGCTAGG - Intergenic
1064133899 10:12733963-12733985 TGGATGAAGCCCCCTGTGGTGGG + Intronic
1065932762 10:30494057-30494079 TGCAGGAAGCCCCAGGGAGCAGG + Intergenic
1068936205 10:62638020-62638042 TGCATGTCCCCACATGGGGTGGG - Intronic
1071845520 10:89517569-89517591 TGCTTGAAACCCCAGGGGTTTGG - Intronic
1075733033 10:124647675-124647697 TCCATGTCACCCCATGGGGTGGG + Intronic
1078059550 11:8034261-8034283 TCCATGAAGCCCAAGGGGGAAGG + Intronic
1081639709 11:44744446-44744468 TGCAAGAAACTCCATGGAGTGGG + Intronic
1083741222 11:64712653-64712675 TGCATGAAGCCCCGTGGGCTTGG - Intronic
1084933752 11:72576116-72576138 TGCAAACAGCCCCATGGGGGAGG + Intergenic
1085289738 11:75389227-75389249 TGCATGACGCCTGATGGGGCTGG + Intergenic
1088223033 11:107590237-107590259 TTAATGAGGCCGCATGGGGTTGG - Intergenic
1093829105 12:23733843-23733865 TGGATGATGTCACATGGGGTTGG + Intronic
1094461825 12:30704545-30704567 AGCATGAAGCCCCAGGAGGTTGG + Intergenic
1097054855 12:56243198-56243220 GGCAGGAGGCCCCATGGGGCAGG + Exonic
1097243723 12:57593782-57593804 AGCATGAAGTTCCATGGGGGTGG + Intronic
1097516691 12:60616489-60616511 TCCATGAAGACCCAAGGGCTAGG + Intergenic
1101545964 12:105713099-105713121 TGGAGGAAGTGCCATGGGGTTGG + Intergenic
1102027934 12:109724031-109724053 TGCAGGAAGCCCCCGGGGATGGG - Intronic
1102640527 12:114362467-114362489 TGCATGAAGCCCCTTGGCTGAGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1112066395 13:95797580-95797602 TGAAAGAAGGCCCATGAGGTTGG - Intergenic
1114693472 14:24606529-24606551 GGCAAGAATCCCCAAGGGGTGGG - Exonic
1117444053 14:55786955-55786977 TGGAAGAAGACCCGTGGGGTGGG - Intergenic
1117490034 14:56237531-56237553 TACATGAAGCCACATGGGAAAGG - Intronic
1118729208 14:68654898-68654920 TGCATGAAGCCAAATGGAGTGGG - Intronic
1119363307 14:74069961-74069983 TGCAGGTAGTCCCATGAGGTGGG - Intronic
1119718192 14:76873530-76873552 TGCATGAAGCCGCATTGAGTCGG - Intergenic
1119891653 14:78187119-78187141 GTCATGAAGCCCCATGAGGCAGG + Intergenic
1121642259 14:95493622-95493644 TGAATGCAGCCCCATGGGATGGG + Intergenic
1122654177 14:103246213-103246235 TGCAGGAAGCCCCATGTGCCTGG - Intergenic
1124566245 15:30816793-30816815 TGCTTGAAGAACCATGGGGGCGG + Intergenic
1124659806 15:31538005-31538027 TGCACGTTGCCCCATGGGGCAGG - Intronic
1125270616 15:37934878-37934900 TCCATAAAGCCCCATGGGCATGG - Intronic
1132063232 15:98709926-98709948 TGATTGAAGACCCCTGGGGTAGG + Intronic
1132224200 15:100127931-100127953 TGAATGCAGCCCCATGGGAGAGG - Intronic
1133799714 16:9075140-9075162 TGCAAGAAGCTGCGTGGGGTGGG + Intergenic
1135725038 16:24847717-24847739 TGCAGGATGCCCAATGGGCTAGG - Intronic
1137753909 16:50886562-50886584 TGCATGAAGCCCAGGGGGCTGGG + Intergenic
1138480784 16:57301722-57301744 GGGATGCAGCCCCATGGGGGTGG + Intergenic
1139249156 16:65478172-65478194 TAAATGAAGCACTATGGGGTAGG - Intergenic
1140965888 16:79965657-79965679 TGCATGAAGCCCAACGCAGTTGG + Intergenic
1141330869 16:83109363-83109385 TGCAGGAAACCCCATGGCTTTGG + Intronic
1141567840 16:84915395-84915417 TCCACGCAGCCCCCTGGGGTGGG - Intronic
1144848262 17:18231202-18231224 TGCCTGGAGCCCCTTGGGTTGGG + Intronic
1146672528 17:34751461-34751483 AGTATGCAGCCCCATGGGCTGGG + Intergenic
1147594282 17:41706524-41706546 TCCATGATCCCCCCTGGGGTAGG - Intergenic
1147884680 17:43676643-43676665 AGCATGAAGCCAAATGGGCTTGG + Intergenic
1152895180 17:82906894-82906916 TGGAAGAAGGCACATGGGGTGGG + Intronic
1156520890 18:37721553-37721575 TGAATTAGGCCCCATGTGGTGGG + Intergenic
1157298434 18:46462394-46462416 GGGATGAGGCCCCATGGGGAAGG + Exonic
1157723062 18:49940504-49940526 TGCAAGAAGCCCCATGGAAATGG - Intronic
1161619879 19:5292418-5292440 TGCAGGAAGCCCCTTGGGGAGGG + Intronic
1163766562 19:19166382-19166404 CCCATGATTCCCCATGGGGTGGG - Intronic
925326312 2:3024538-3024560 TGCATGAGGCCTCTTGGGGGCGG - Intergenic
925611042 2:5703412-5703434 TGCAGGAAACCCCATGGAGCTGG - Intergenic
926158506 2:10471654-10471676 TGCAACAAGCCCCCTGAGGTAGG - Intergenic
927526314 2:23744573-23744595 TGCAGTAACCACCATGGGGTTGG + Intergenic
928215381 2:29356964-29356986 TGGCTGAAGCCCCAGAGGGTGGG - Intronic
928217893 2:29377537-29377559 TTCATGAAGCCCCATTGAGGGGG + Intronic
928308964 2:30194112-30194134 TGCATTAAGCGCCATGGGCACGG - Intergenic
928483135 2:31703859-31703881 AGAATGAAGCCCCATGGTGGAGG - Intergenic
929047269 2:37802235-37802257 TTCCTGAAGCCCCTTGGGGCAGG + Intergenic
932343041 2:70978733-70978755 TGCATGGAGCCACTTGGAGTTGG - Exonic
933844259 2:86312719-86312741 TGACTGTAGCCCCATGGGGTAGG - Intronic
936657292 2:114503144-114503166 TGCATGAAGCCCCATGCTATTGG - Intronic
941918352 2:170826784-170826806 TACATGAGGCCACATGGGTTTGG + Intronic
948579166 2:238972265-238972287 TGCATGAGGCCCCATGTAGGTGG - Intergenic
948952277 2:241261721-241261743 TCCATGAAGCCAGCTGGGGTTGG + Intronic
949021577 2:241743898-241743920 TGCATGGGGCCCCTCGGGGTGGG + Intronic
1172838933 20:37890493-37890515 TGCACAAGGCCACATGGGGTTGG + Intergenic
1173167543 20:40696210-40696232 AGCAGGGAGGCCCATGGGGTGGG - Intergenic
1173725085 20:45291718-45291740 GGCTTCAAGCCCCATGTGGTAGG + Intergenic
1175390105 20:58621730-58621752 TGGATGGAGCTCCTTGGGGTGGG - Intergenic
1175737675 20:61398633-61398655 TGGATGAAACTCCATGGTGTGGG - Intronic
1175853105 20:62104343-62104365 TGCACGCAGCCCCAGGGGGACGG + Intergenic
1176016719 20:62937750-62937772 TGCGTGAGGCCGCACGGGGTGGG - Intronic
1181547855 22:23613427-23613449 TGTATGAAGCAGCATGGAGTGGG - Intronic
1182885592 22:33771351-33771373 TGTGTGAAGCCAAATGGGGTAGG + Intronic
1183063171 22:35347665-35347687 TGCATGGGGCCCCATGGCTTTGG + Exonic
1184108976 22:42384186-42384208 TGGATGAAGCCACAGGTGGTGGG + Exonic
949478657 3:4472556-4472578 TGCAAGAAATCCTATGGGGTTGG + Intergenic
950098721 3:10344751-10344773 TTCATGCAGCTCCATGAGGTGGG - Intronic
950126854 3:10514869-10514891 TGCAGGTGGCCCCAGGGGGTTGG + Intronic
954848647 3:53581807-53581829 TGCAAGAAGGCCCATCTGGTTGG + Intronic
958882772 3:99691645-99691667 AGAATGAAGCCCCATGAGGGTGG - Intronic
960063465 3:113347603-113347625 TGCCCAAAGCCCCATTGGGTGGG + Intronic
960130015 3:114045704-114045726 TGCAGGAAGACCCATGTGGCTGG - Intronic
963561834 3:146875833-146875855 TGCATGAGTCCCGATGGGGCTGG + Intergenic
966914395 3:184576958-184576980 TGCAAGAAGTGCCATGGGGCTGG + Exonic
968737302 4:2304079-2304101 TGCATGACGCCCCACAGGGCAGG + Intronic
971178132 4:24301402-24301424 TGCAAATAGCCCTATGGGGTAGG + Intergenic
973649126 4:52980041-52980063 TGAATGGTGCCCCTTGGGGTTGG + Intronic
974340394 4:60607774-60607796 TCCAGGAAGGCCCATAGGGTGGG + Intergenic
988202378 5:28084034-28084056 TGCATGGAGCCCCAAGGTCTGGG - Intergenic
991227777 5:64292763-64292785 GGAATGAAGCCCCATGGGGGAGG - Intronic
992242665 5:74787951-74787973 TGAATGAAGCCCCTTGAGGAAGG + Intronic
993783376 5:92097672-92097694 AGCATGAAGTCCCAGGAGGTAGG - Intergenic
997787066 5:136723123-136723145 AGCATGAAGCCCCCTGGGAAGGG - Intergenic
998343806 5:141442461-141442483 TGCAGAAAGCCCCTTGGGGAAGG + Intronic
1001883991 5:175271845-175271867 GGCATGAAGACCAGTGGGGTGGG - Intergenic
1001906964 5:175480620-175480642 TCTATGAAACCCCATGGGGATGG + Intronic
1002575044 5:180169790-180169812 GGCTTGGAGCCCCATGGGGTCGG - Intronic
1002596863 5:180329303-180329325 TGCCTGAAGCCCCCTGGTTTGGG - Intronic
1006167487 6:32073576-32073598 TGGAAGAAGGGCCATGGGGTGGG + Intronic
1007109162 6:39303235-39303257 TGCATGAAGCCGCTTGAGGCTGG + Intronic
1007323706 6:41044442-41044464 TGTGTGAAGGCCCATGGGGGAGG + Intronic
1007729237 6:43935841-43935863 AGCATGAGGGCCCATGGGGGAGG + Intergenic
1012952381 6:105532252-105532274 TGCATGAAGCCCAATTTGGCTGG + Intergenic
1013634913 6:112020099-112020121 TGCACAAAGCCCCATGGGGTAGG + Intergenic
1016821259 6:148348484-148348506 TGCATGCAGCTCTATGGGGACGG + Intronic
1019074992 6:169379777-169379799 TGCGTGAAGCCCGATGGCTTTGG - Intergenic
1019556279 7:1633168-1633190 TGGGTGAAGCCACATGGGGGTGG + Intergenic
1021839357 7:24709979-24710001 AGAATGACGCTCCATGGGGTAGG - Intronic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1025029735 7:55547289-55547311 TGCATGTAGCCCCAGGGGGAAGG - Intronic
1030288679 7:107850821-107850843 TCCATGAGGCCCCATGGACTGGG + Intergenic
1034250769 7:149688812-149688834 TGCATGAAGCACTGTGGAGTAGG - Intergenic
1035675636 8:1453788-1453810 TGCATGATGCCTTATGGGTTGGG - Intergenic
1037376488 8:18235654-18235676 TGTATGAAGCCCGTTGGTGTGGG + Intergenic
1039236907 8:35511816-35511838 TGCATGTAGCCACATGGAGTAGG + Intronic
1040526951 8:48234047-48234069 TGCCCAAAGCCCCATTGGGTGGG + Intergenic
1042750888 8:72156299-72156321 TGCTTGAAGCTCCAGGAGGTCGG - Intergenic
1044026961 8:87184483-87184505 TGCATGAAGCCCAGAGGGTTTGG - Intronic
1044055580 8:87565986-87566008 AGCAGGAAGCCCTTTGGGGTGGG + Intronic
1044414900 8:91926315-91926337 TGCAGGATGCCCCATGCGGCAGG + Intergenic
1046748751 8:117904691-117904713 TTCATGAAGCCACCTGGTGTTGG - Intronic
1050116636 9:2270365-2270387 TTCATGAAGAACAATGGGGTAGG - Intergenic
1053143646 9:35697598-35697620 GGCATGAAGGCACTTGGGGTTGG + Exonic
1053162209 9:35820968-35820990 TGTATGAGGCCCCATGCAGTGGG + Intronic
1057529799 9:95834435-95834457 TTCAAGAAGCCCCAAGGTGTTGG + Intergenic
1060219095 9:121755033-121755055 GGTATGAAGCCCCATGTGGGAGG + Intronic
1186854182 X:13610346-13610368 AGCAGGGAGCCCCATGGAGTAGG + Intronic
1190629255 X:52368956-52368978 TGCATGACGCGGGATGGGGTGGG + Intergenic
1190730347 X:53221750-53221772 GGGAGGAAGCCCCAGGGGGTGGG + Intronic
1195082375 X:101383911-101383933 TGCATGAAGCCATCTGGGGAGGG - Intronic
1199843812 X:151676227-151676249 TGCGTAAAGTCCCTTGGGGTAGG + Exonic