ID: 907326910

View in Genome Browser
Species Human (GRCh38)
Location 1:53644208-53644230
Sequence CTGGGGCAGAGCCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907326910_907326913 -9 Left 907326910 1:53644208-53644230 CCCTCCACTTGGCTCTGCCCCAG 0: 1
1: 0
2: 7
3: 39
4: 474
Right 907326913 1:53644222-53644244 CTGCCCCAGAGAGCCTCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907326910 Original CRISPR CTGGGGCAGAGCCAAGTGGA GGG (reversed) Intronic
901150803 1:7099958-7099980 CTGGGGCAGAGGCCAGGGGGTGG + Intronic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901972034 1:12915667-12915689 CTGGGGCAGATGCCAGAGGAAGG - Intronic
902013145 1:13286095-13286117 CTGGGGCAGATGCCAGAGGAAGG + Intergenic
902280709 1:15372185-15372207 CTGGAGCAGAGCCAGAAGGAAGG + Intronic
902281409 1:15377378-15377400 CTGGAGCACTGCCAAGGGGAAGG - Intronic
902926345 1:19698248-19698270 CTGGGGCAGAGCCCACAGGGTGG + Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
903291674 1:22318077-22318099 CTGAGGCAGAGCCAGGTGTGTGG + Intergenic
903305684 1:22411427-22411449 CTAGAGCAGAACCAAGAGGAAGG + Intergenic
904302262 1:29561899-29561921 CTGGGTCAGAGCACAGTGGCTGG - Intergenic
904442441 1:30540535-30540557 CTGTGGCAGGGCCAAAGGGAAGG + Intergenic
905444391 1:38016188-38016210 CTTGGGCAGAGCCCAGTTGTGGG + Intronic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905908532 1:41637847-41637869 CTGGGGCAGAGCAGAATGGGGGG + Intronic
905923331 1:41733254-41733276 CAGGGGCAGAGCCAAGGGATGGG + Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907462151 1:54611518-54611540 CTGGAGCAGAGCTGGGTGGAAGG - Intronic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909271559 1:73628913-73628935 CTGGGGCACTACCTAGTGGAGGG - Intergenic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910413543 1:86972454-86972476 TTGGGGCTGAGCCAGGAGGATGG - Intronic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912646883 1:111401588-111401610 CTGTGGAAGAGCCAAGGGCAGGG - Intergenic
912701501 1:111881648-111881670 CTGGGGCAGGGCAAAGGGCAGGG + Intronic
913588426 1:120299386-120299408 CTGGGGCCTACCCCAGTGGAAGG + Intergenic
913619759 1:120598983-120599005 CTGGGGCCTACCCCAGTGGAAGG - Intergenic
913968623 1:143397101-143397123 CGAGGGCAGAGCCACCTGGAGGG - Intergenic
914063002 1:144222700-144222722 CGAGGGCAGAGCCACCTGGAGGG - Intergenic
914116148 1:144743654-144743676 CGAGGGCAGAGCCACCTGGAGGG + Intergenic
914570443 1:148911259-148911281 CTGGGGCCTACCCCAGTGGAAGG + Intronic
914602387 1:149219010-149219032 CTGGGGCCTACCCCAGTGGAAGG - Intergenic
914707072 1:150179156-150179178 CTGGGGCAGAGGCAGTGGGAAGG - Intergenic
914914867 1:151813432-151813454 AGGGGACAGAGCCAAGTGGAGGG - Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915549255 1:156623328-156623350 CTGGGGCAGAGAAAAGGGGTTGG - Intronic
915943246 1:160132270-160132292 CTGGGTCAGAGCCAGTTGGAAGG + Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
917693732 1:177495999-177496021 CTGGGAGAGACCCAAGGGGAGGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918038254 1:180896214-180896236 CTGGGGCAGAGGCACATGAATGG + Intergenic
918659091 1:187067312-187067334 CTGGGGCTGTGCCAGGTGGGAGG + Intergenic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920639440 1:207737668-207737690 CTGGGGCAGAGTGAAGAGGCAGG + Intronic
921266479 1:213424913-213424935 CTGGGACAGAGGCAAGCTGAGGG - Intergenic
921284040 1:213593141-213593163 GTGGGGCACAGCGAGGTGGAAGG + Intergenic
1063840421 10:10065462-10065484 CGAGGACAGTGCCAAGTGGATGG + Intergenic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1065726396 10:28671359-28671381 ATGGGGTGGAGCCAAGTGGATGG + Intergenic
1067101747 10:43339230-43339252 CCGAGGCAGGGCCACGTGGAGGG + Intergenic
1067528257 10:47051335-47051357 ATGGGGCACTTCCAAGTGGATGG + Intergenic
1067666412 10:48283346-48283368 TTGGAGCAGAGCCCAGAGGAGGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068579628 10:58724630-58724652 CTGGGGCAGAGCCAAAAGCCAGG - Intronic
1068960067 10:62858682-62858704 CTGGGTTAAAGCCAAGTGGTTGG - Intronic
1070283352 10:75066283-75066305 ATGGGGCACTGCCAAGTTGAAGG - Intergenic
1072944751 10:99799649-99799671 CTGAGCCAGATCCAAGTGGCGGG + Intronic
1074146589 10:110721997-110722019 CAGGGGCAGAGACAAGGAGAAGG - Intronic
1075282027 10:121147411-121147433 CTGGGACAGATCCCAGAGGAAGG - Intergenic
1075599796 10:123759118-123759140 GTGGGACAGAGCCAAGTCAATGG + Intronic
1075641540 10:124068145-124068167 CAGAGGCAGAGCCAAGGGGATGG + Intronic
1075880878 10:125849652-125849674 CTGCGGCAGAGCTATGGGGAGGG + Intronic
1076138388 10:128060563-128060585 CTGGGGCTGGGCCCAGTGCAGGG + Intronic
1076407941 10:130225833-130225855 CAGGGGCAGGTCTAAGTGGAAGG - Intergenic
1076514115 10:131033574-131033596 CTGGGGCAGGACCAAGGTGATGG + Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1076569180 10:131421108-131421130 ATGGGGCAGGGCCAACAGGAGGG - Intergenic
1076907648 10:133371472-133371494 CTGGGGCGGTACCAAGTGCAAGG - Intronic
1077222683 11:1424503-1424525 CTGGGGTGGGGCCAAGTGGCAGG + Intronic
1077305957 11:1868778-1868800 CAGGGCCAGAGCCCAGAGGACGG + Intronic
1078620533 11:12903024-12903046 CTGAGGCAGAGCCCAGAGGAAGG - Intronic
1080892030 11:36417359-36417381 ATGGGGCAGCCCCAAGTGGACGG - Intronic
1082705176 11:56486011-56486033 CTGGGACAGAGGCAAGGGAAGGG - Intergenic
1082827632 11:57592241-57592263 CTTTGGGAGACCCAAGTGGATGG - Intergenic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083639431 11:64137295-64137317 CTGGGGCACAGCCATGTGAGGGG + Intronic
1083694861 11:64436124-64436146 CTGGCCCAGAGCCATGTGGTAGG - Intergenic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1083912496 11:65718440-65718462 CTGAGGCACAGAGAAGTGGAGGG + Exonic
1084952415 11:72674024-72674046 ATGGAGCTGAGCCACGTGGAAGG - Intronic
1085049211 11:73371353-73371375 CTGGTGCAGGCCCAGGTGGATGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1086879605 11:92138037-92138059 GTGGGATAGATCCAAGTGGAAGG - Intergenic
1088553457 11:111037805-111037827 CTGGGGGTGAGACATGTGGATGG - Intergenic
1090221524 11:125030968-125030990 CTGGGGAAGAGTTATGTGGACGG - Intronic
1090452358 11:126817904-126817926 CTCAGCCAGAGCCAAGAGGACGG - Intronic
1091631120 12:2161653-2161675 CTGGGGCACAGCCAAACTGACGG + Intronic
1091662583 12:2395616-2395638 CTCTGGAAGAGCCAAGTGGCTGG + Intronic
1091991995 12:4962945-4962967 CTGGGGCAGAGCCTTCTAGAAGG + Intergenic
1092209847 12:6639112-6639134 CTAGGGCAGAGCCAGGGGCAGGG + Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096188416 12:49599084-49599106 ATGGGGCAGAGAAAAGTGGGAGG + Intronic
1096572238 12:52530272-52530294 TTGGGGCAAAGCAATGTGGAGGG - Intergenic
1096669999 12:53192911-53192933 CTGGGGTAGAGCCATGCAGAGGG + Exonic
1096949767 12:55455714-55455736 CTTTGGGAGAGCGAAGTGGAAGG + Intergenic
1096977754 12:55708907-55708929 CTGGGACAGAGGCAAGGGGGTGG + Intronic
1097161510 12:57049456-57049478 CTTGGGGAAAGCCAAGTGAAGGG - Intronic
1098325607 12:69298688-69298710 CTGAGGCACTGCCTAGTGGAGGG + Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1100277192 12:93082034-93082056 TGGGGAGAGAGCCAAGTGGAGGG - Intergenic
1101172612 12:102114589-102114611 TTGGGGCAAAGCCAGGTTGATGG + Intronic
1101508878 12:105374994-105375016 CTGGTGCAGAGCCATAGGGAAGG + Intronic
1102207561 12:111100926-111100948 CTGGGGCTGAGGCAAGAGGCTGG - Intronic
1102730405 12:115103995-115104017 CTGGGGCAGGGCCAAGGGCAGGG - Intergenic
1103561220 12:121794107-121794129 CTGGGGCAGTGCAAAGTTGAGGG - Exonic
1104115018 12:125741356-125741378 CTGGAGCAGAGACAATTGCAGGG + Intergenic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1104917381 12:132272867-132272889 GTGGCGCAGAGCCACGGGGAAGG - Intronic
1108422382 13:50264531-50264553 CATGGGTAGAGCCAAGTGAATGG + Intronic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1110417992 13:75272929-75272951 TTTGGGCAGATCCAGGTGGAGGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1113037212 13:106063156-106063178 CTGGGGCAGAGTTGAATGGATGG + Intergenic
1113819672 13:113204170-113204192 CTGGGGCTGGGCCCAGTGCAAGG - Intronic
1114601550 14:23959451-23959473 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114605728 14:23994581-23994603 GGGGGGCTGAGCCAAGAGGATGG + Intronic
1114626015 14:24130941-24130963 CTAGGGCAGAGCCAAGCTGCTGG + Intronic
1114765136 14:25362026-25362048 CTTGGGAAGAGTCAAGTGGATGG + Intergenic
1115130780 14:30049892-30049914 TTGGGGAAGAGCTATGTGGATGG + Intronic
1115328273 14:32166411-32166433 CTGGGGCAGAGACATGTGGATGG + Intergenic
1117328715 14:54691745-54691767 CTGGGGCACAGCCCTGTAGAGGG - Intronic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1119668343 14:76500103-76500125 CTGGGGTAGAGCCAAGGAGGTGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120946104 14:89998703-89998725 TAGGGGAAGAGCCATGTGGATGG + Intronic
1121302624 14:92883979-92884001 CTGAGGCAGACCCTAATGGATGG - Intergenic
1121624028 14:95371617-95371639 ATGGGGCAGACGCAGGTGGAAGG + Intergenic
1122208744 14:100161239-100161261 CTGGGGCAGAGGGAACTGGCAGG - Intergenic
1122910544 14:104825875-104825897 CTGGGGCGTAGCGAAGTGGCAGG + Intergenic
1123067817 14:105627159-105627181 CTGGGGCCGAGCAGAGGGGATGG - Intergenic
1123071835 14:105645884-105645906 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123072659 14:105649258-105649280 CTGGGGCTGAGCAGAGGGGATGG + Intergenic
1123091499 14:105744160-105744182 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123097267 14:105772501-105772523 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123167171 14:106336883-106336905 CTGGGGCAGATGCCACTGGATGG + Intergenic
1123169787 14:106361594-106361616 CTGGGGCAGATGCCACTGGATGG + Intergenic
1123199160 14:106645259-106645281 CTGGGGCAGATACAACTGGATGG + Intergenic
1125543808 15:40488245-40488267 CTGCTGCAGAGCCCAGTGGTGGG - Intergenic
1125665821 15:41429314-41429336 CAGGGACAGAGAGAAGTGGAAGG - Intronic
1126702887 15:51383614-51383636 CTGAAGCAGTGCCAAGTGGGGGG - Intronic
1126779408 15:52125763-52125785 CTGGGGCAGGACAAAGTGGGAGG + Intronic
1126993299 15:54408980-54409002 CTGGGGCACAGACAAGAGAAGGG + Intronic
1127027387 15:54821964-54821986 ATGGGGCAAAGCCCAGAGGAAGG + Intergenic
1127298741 15:57632310-57632332 CTGCTGCAGAACCCAGTGGATGG + Intronic
1128723542 15:69971057-69971079 CTGGGGCAGGGACAAGGGAACGG - Intergenic
1129649516 15:77472647-77472669 ATGGGGCTGAACCAAGTGGGAGG - Intronic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1131135405 15:89930962-89930984 CCGGGGCAGAGGGAAGAGGAAGG + Intergenic
1131512728 15:93058233-93058255 ATGGGGCAGTGCCCAGTGGGAGG + Intronic
1131848853 15:96516493-96516515 CAGGGGCAAAGACAAATGGATGG - Intergenic
1132636427 16:952083-952105 CTGGGGCGGAGCCACGTTGTGGG + Intronic
1133695847 16:8261722-8261744 CTGGGGTAGAGTTAAGTGAAGGG - Intergenic
1133852359 16:9517395-9517417 CTGGGGCACAGCAAAGAGCATGG - Intergenic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134411016 16:14003363-14003385 CAGGAGCAGAGGGAAGTGGAAGG - Intergenic
1135293748 16:21261940-21261962 CTGGAGCAGACCAAACTGGAAGG + Intronic
1135387648 16:22057959-22057981 CTTGTGTAGAGCCAAGTGGGGGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135617070 16:23920704-23920726 CTGGGGCAGAGCCCAGGGGAAGG + Intronic
1136107502 16:28040687-28040709 AGGGGCCAGAGCCCAGTGGAGGG - Intronic
1136112723 16:28074979-28075001 CTGAGGCACAGCCCAGTGCAAGG + Intergenic
1136718178 16:32301454-32301476 CTGGGGCAGGGCCAAGTTCTGGG + Intergenic
1136836552 16:33507724-33507746 CTGGGGCAGGGCCAAGTTCTGGG + Intergenic
1137005966 16:35274579-35274601 CATGAGCAGAGCCAAGTGGGAGG + Intergenic
1137521756 16:49200924-49200946 CAGGGACTGAGCCAAGTGCATGG - Intergenic
1137774187 16:51041800-51041822 CTCCTGCAGAGCCAAGTGCAGGG + Intergenic
1137982619 16:53082741-53082763 TTCAGGCAGAGCCAAGTGCATGG - Intronic
1138322752 16:56131274-56131296 CTGGGGTAGAGGCAAGGGAAAGG + Intergenic
1138386559 16:56639356-56639378 CTGGGGCTGAGCCAAGTCAGAGG + Intronic
1138428140 16:56950285-56950307 CTCAGGCAGAGCCAAGGGGAGGG - Intergenic
1138693294 16:58788776-58788798 CTGGAGCAGAGCTCAGTGTAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141326430 16:83063918-83063940 GTTGGGGAGAGGCAAGTGGAAGG + Intronic
1141383415 16:83596692-83596714 GTAGGTCAGAGGCAAGTGGAAGG + Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141715985 16:85727101-85727123 CTGGGCCAGCGCCCAGTGCACGG + Intronic
1142090326 16:88206586-88206608 CTGGACCAGAGACAAGTGTAGGG - Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142302677 16:89267934-89267956 CTGGTGCGGAGCCAGGCGGAGGG - Exonic
1203008250 16_KI270728v1_random:216311-216333 CTGGGGCAGGGCCAAGTTCTGGG - Intergenic
1203146739 16_KI270728v1_random:1808025-1808047 CTGGGGCAGGGCCAAGTTCTGGG + Intergenic
1142735885 17:1899129-1899151 CAGGGGCAGTGCCAGGGGGAGGG + Exonic
1142774267 17:2123920-2123942 CTGGGGCAGTGTTAAATGGAGGG - Intronic
1143247863 17:5500990-5501012 CTGGGTCAGAGCGCAGTGGGCGG + Intronic
1144462249 17:15467596-15467618 TTGGGGCAGGGGCAAGAGGATGG - Exonic
1146280580 17:31541744-31541766 CTGGAGCAGAGCCAGGAGGTAGG + Intergenic
1146518334 17:33507036-33507058 CTGGGGCAGGGTCAAGGGGCCGG + Intronic
1146618441 17:34375790-34375812 CGGGGACAGCGCAAAGTGGATGG + Intergenic
1147153266 17:38530612-38530634 CTGGTGCAGACCCAAGTGTGTGG - Exonic
1147654099 17:42078723-42078745 CTGGGGCAGAGGCAGGGGCATGG + Intergenic
1149244575 17:54690457-54690479 CTGAGGCTGAGCCAAAAGGAGGG - Intergenic
1150290654 17:63979636-63979658 CAGGGGTGGAGGCAAGTGGAAGG - Intergenic
1150787392 17:68174117-68174139 CTGAGTCAAAGCCAAGGGGAAGG - Intergenic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151553178 17:74833760-74833782 CTTGGGCAGGGCCAAGTGCCAGG + Intronic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1152623826 17:81379419-81379441 CTGGGGCAGAGCCCAGGAGCTGG + Intergenic
1152746057 17:82039877-82039899 CTGGAGGACAGCCAAGTGCATGG + Intergenic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1153908907 18:9689254-9689276 TTGGGGGAGGGCCAAGGGGAGGG - Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1157009449 18:43628550-43628572 ATGAGGCAGATCCAAGTGGAAGG + Intergenic
1157684701 18:49632701-49632723 CTCGTGCAGAGCTAAGTGCACGG + Intergenic
1158118589 18:54024206-54024228 TGGGGGAAGAGCCCAGTGGAAGG + Intergenic
1158676413 18:59523279-59523301 GTTGGGCAGAGCCCAGTGGTGGG + Intronic
1159435073 18:68405888-68405910 CTAGGTCAGACCAAAGTGGAAGG - Intergenic
1159802805 18:72921663-72921685 TTGGGGCAGAGGCGAGGGGAGGG + Intergenic
1160364073 18:78309338-78309360 CTGGAGCAGAGCCCAGGCGAGGG - Intergenic
1160631535 18:80249815-80249837 CTGGTCCAGAGCCAAGTCTAGGG - Intergenic
1160810807 19:1012230-1012252 CTGGGGCAGGGCCCAGGGGGTGG - Intronic
1161658845 19:5533513-5533535 CTGGGGCAGAGCCAAGCAAGAGG + Intergenic
1162490281 19:10987443-10987465 CTGGGGCTGGCCCCAGTGGAGGG + Intronic
1162789498 19:13055599-13055621 CTGAGGCTGCTCCAAGTGGAGGG - Intronic
1163003307 19:14382263-14382285 CTGGGCCAGCCCCAAGTGGCAGG + Intronic
1163034264 19:14562357-14562379 CGTGGGCAGAGCCGAGTGGCAGG + Intronic
1163256758 19:16160699-16160721 CTGGGGCAACCCCAGGTGGAGGG + Intergenic
1163267517 19:16229860-16229882 CTGCCGCAGCGCCACGTGGAAGG - Intronic
1163591453 19:18196378-18196400 TTGGCCCAGAGCCAGGTGGATGG - Exonic
1163612215 19:18307577-18307599 CTGCAGCAGAGCCAGGTGGGTGG + Intronic
1163745342 19:19043395-19043417 CTGGGGCAGAGGCAGGGGGCTGG + Intronic
1164457211 19:28418706-28418728 CTAGGGCACAGCCATGTGCATGG - Intergenic
1164515551 19:28932420-28932442 CTGGGAAAGATCCAAGTGGTTGG - Intergenic
1165300173 19:34963742-34963764 CTGGGGCACGGCCAGGTGGGTGG - Exonic
1165361226 19:35338138-35338160 AGGGGGCAGAGGCGAGTGGAGGG - Intronic
1166802243 19:45465439-45465461 CTGTGGCAGAGCCAAGGCGATGG - Intronic
1166980581 19:46629851-46629873 CAGGGCCAGAGCCAGGAGGACGG - Intergenic
1167019515 19:46862953-46862975 CTGAGGCAGCTCCAAGAGGAAGG - Intergenic
1167537748 19:50065801-50065823 CTGGGGCGGTGTCAACTGGAGGG + Intergenic
1168137108 19:54359364-54359386 CCAGGGCAGAGCCAGATGGAAGG + Intronic
1168160968 19:54509721-54509743 CCAGGGCAGAGCCAGATGGAAGG - Intronic
1168313594 19:55473831-55473853 CTGGGTCATAGCAATGTGGAGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1202702412 1_KI270712v1_random:174571-174593 CGAGGGCAGAGCCACCTGGAGGG - Intergenic
925284917 2:2709578-2709600 CTGGGGCACAGCCAGAGGGACGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926056644 2:9777667-9777689 CAGGGACAGAGCCAAGGGCAGGG - Intergenic
926146486 2:10399701-10399723 CAGGGGCAGAGAGAAGCGGAAGG - Intronic
929343117 2:40847285-40847307 CTTGGGGAGACCGAAGTGGAAGG + Intergenic
930154771 2:48094719-48094741 CTGAGGCAGAGGCAAGAGCATGG + Intergenic
931954062 2:67397877-67397899 CTGTGGCGGAGGCAAATGGATGG - Intronic
932579882 2:72986220-72986242 CTGAGGCTGAGCCAGGTGGCTGG + Intronic
932869356 2:75381262-75381284 CTGGGGCAGAGCAAGGGGGTGGG + Intergenic
933260635 2:80127520-80127542 CTAGGACATAGCCAAGTGTATGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933937750 2:87219955-87219977 CTGGGGCAGAGTGCGGTGGAGGG + Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934173324 2:89558025-89558047 CGAGGGCAGAGCCACCTGGAGGG - Intergenic
934283639 2:91632378-91632400 CGAGGGCAGAGCCACCTGGAGGG - Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934943464 2:98519377-98519399 CTGGGCCTAAGCGAAGTGGAGGG - Intronic
935253093 2:101282829-101282851 GGGGGGCACAGCCCAGTGGAGGG - Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935739937 2:106138540-106138562 CTGGGCCAGAGCACCGTGGAGGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936475309 2:112834574-112834596 CTGGAGCAGAGCCAAGCTGCTGG + Intronic
937031723 2:118746250-118746272 CTGGGGTAGAGCCAGGTAGATGG + Intergenic
937084934 2:119165282-119165304 CTGGGGCACAGCAAAGAGGCTGG + Intergenic
937626570 2:124050610-124050632 CAGGGGCAGAGTCAACAGGATGG - Intronic
938086773 2:128407077-128407099 CTGGGGCCTGGCCAGGTGGACGG + Intergenic
938152434 2:128899195-128899217 CTGAGGCAGAGCCAGGTACAGGG - Intergenic
938278398 2:130048370-130048392 CTGGAGCAGAGCCAATGAGAGGG + Intergenic
938360574 2:130682274-130682296 CTGGAGCAGAGCCAATGAGAGGG - Intergenic
938436977 2:131288982-131289004 CTGGAGCAGAGCCAATGAGAGGG - Intronic
939150879 2:138471117-138471139 CAGTGGCTGAGCCACGTGGATGG - Intergenic
941333285 2:164207500-164207522 ATTGGGCAGGGCCAAGTGGTGGG - Intergenic
942711243 2:178838747-178838769 TTGGAGCAGAGACAAGTGGCAGG - Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
945725765 2:213470872-213470894 TTGGGGCAGAGATATGTGGATGG - Intronic
946027273 2:216679454-216679476 CTGGGGGATGGCCAAGTAGATGG + Intronic
946044676 2:216811018-216811040 CTGGGGCTGAGCCCAGTGCTTGG - Intergenic
946372657 2:219290229-219290251 CTGGGGCAGGGCCTTGAGGATGG + Exonic
947198501 2:227593937-227593959 CTGGTCCAGATCCAAGTGGATGG + Intergenic
947810198 2:232999360-232999382 CTGGGTCAGAGACAAGGGGAGGG - Intronic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
949015770 2:241709465-241709487 AATGGGCATAGCCAAGTGGAAGG + Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949063501 2:241975044-241975066 CATGGGGAGAGCCAAGTGAAGGG - Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169840667 20:9933271-9933293 CTGTGGCAGAGTGGAGTGGACGG + Intergenic
1171002947 20:21433306-21433328 CTGGTGCTGAGCCATGTGCATGG - Intergenic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171880283 20:30613620-30613642 CTGGAGCAGAGCCAATGAGAAGG + Intergenic
1172588728 20:36102874-36102896 GTGGGTCAGTGCCAAGGGGAGGG + Intronic
1172600162 20:36177794-36177816 AGAGGGCAGAGCCAAGTGGGTGG + Intronic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1173248502 20:41352254-41352276 CTGGTGCTGAGCCCAGAGGATGG + Intronic
1174107803 20:48175371-48175393 CTGGGACAGAGCCCAGCAGAAGG - Intergenic
1175370339 20:58483942-58483964 CTGAGGCAGAGGCCAGGGGAGGG + Intronic
1175408452 20:58750664-58750686 CTGGGGCAGAGTCACGTCTAAGG + Intergenic
1175478825 20:59297140-59297162 CTGGGGCTCGGCCAAGTGCACGG - Intergenic
1175581507 20:60103485-60103507 CTAGGGCAGAGCTCAGAGGAGGG + Intergenic
1175735644 20:61385296-61385318 CTGGGGCCCATCCAGGTGGATGG - Intronic
1175874547 20:62223158-62223180 CTGGGCCAGAGCCATGTGGACGG + Intergenic
1175900857 20:62359386-62359408 CTGCGGCAGAGCCAGGGGGTGGG + Intronic
1176142951 20:63553311-63553333 CTTGGGCAGCCCCAGGTGGAAGG + Intronic
1176164336 20:63664874-63664896 CTGGGGCAGAGCCTCTGGGACGG + Intronic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1178686003 21:34711127-34711149 CAGGGCCAGAGCCAGGTGGTTGG + Intronic
1179619202 21:42601535-42601557 TTGGGAGAGACCCAAGTGGAAGG + Intergenic
1180872350 22:19153544-19153566 CGGGGCCAGAGCCATCTGGAAGG - Intergenic
1181065243 22:20302723-20302745 CTGGGGCAGATGTAAGGGGAAGG + Intergenic
1181420802 22:22797039-22797061 TTGGGGAAGAGCTATGTGGATGG - Intronic
1182020820 22:27080220-27080242 CTTGGCCAGAGCCCTGTGGAGGG - Intergenic
1183299833 22:37053375-37053397 CTGGGGCTCTGCCAAGCGGACGG + Intronic
1183589467 22:38771377-38771399 CAGGGGCAGAGACCAGAGGAAGG - Intronic
1184198105 22:42945694-42945716 TGGGGACAGAGCCAAGTGGGAGG - Intronic
1185276407 22:49951825-49951847 CTGGGGCAGGGCCAGTTGGAAGG + Intergenic
1185289420 22:50016136-50016158 CTGGGCCAGGACCAAGTGGGTGG + Intronic
1185369888 22:50456144-50456166 CTTGGGTAGAGCCAAGTGGACGG - Intronic
950413855 3:12856876-12856898 CTGGGGCAGGGCCAGGTGCTGGG - Intronic
950864188 3:16175654-16175676 CTCGGGCAGAGCCCTCTGGAGGG - Exonic
951710867 3:25583954-25583976 TGGGGGCAGAGCCAGGTGAAGGG - Intronic
952215442 3:31273436-31273458 CTGGGGCAGAGACAATGGGTTGG + Intergenic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
954325296 3:49860170-49860192 CTTTGCCAGGGCCAAGTGGAAGG - Exonic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
955330712 3:58044771-58044793 CTGGAGCAGAGGCAAGTTCAGGG - Intronic
955964401 3:64373462-64373484 CTGTGGGAGACCAAAGTGGAAGG + Intronic
957458504 3:80486202-80486224 CAGGGGCAGAGGCAGGTGTATGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
961324630 3:126102928-126102950 GAGGGGCAGAGCCAGGTGGGTGG + Intergenic
963542293 3:146608013-146608035 ATGGCACAGAGCCAAGAGGATGG - Intergenic
963880920 3:150527354-150527376 CTTGGGCAGAGCTGGGTGGAGGG - Intergenic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
967147788 3:186620690-186620712 CTGGGGGTGAGCCAGCTGGAGGG - Exonic
967932863 3:194702991-194703013 TTGGGGCTCAGCCAAGGGGAAGG + Intergenic
968121757 3:196130810-196130832 ATGGGGCTGAGGCAAGTCGAGGG + Intergenic
968511204 4:996715-996737 CTGAGGCAGAGACACGTGGGAGG - Intronic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
969527238 4:7710100-7710122 CTGGGGCAGAGCAGAGAGGCTGG - Intronic
969694291 4:8725946-8725968 CTGGAGCAAAGCCGTGTGGAGGG + Intergenic
970610569 4:17721587-17721609 CCGGGGCAGAGCCGAGGTGAAGG + Intronic
971127501 4:23770510-23770532 CTGGAGCGGAGACATGTGGATGG - Intronic
974297825 4:60025545-60025567 CTGTGGAAGACCAAAGTGGAAGG - Intergenic
974932826 4:68378797-68378819 CTGGGGCAGAGGCATGGGGCAGG + Intergenic
978757482 4:112319095-112319117 CTGGGAAAGAGACAAGTGGCAGG + Intronic
978774592 4:112492880-112492902 AAGGGTGAGAGCCAAGTGGACGG - Intergenic
979291995 4:118988761-118988783 CTTGGGCAAAGCCAAGTGTGAGG - Intronic
979328500 4:119404570-119404592 CTGGGGCAGAGGCAGGGGCAAGG - Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
981315791 4:143337935-143337957 CTGGGGGGGAGCCTAGTGGCTGG + Intronic
981336551 4:143574748-143574770 CTGGGACAGAGCCTAGTTGTTGG + Intergenic
982300995 4:153879406-153879428 CTGGGGAAGAGATATGTGGATGG + Intergenic
984418176 4:179487038-179487060 TTGGGGGAGAGACATGTGGATGG - Intergenic
985067441 4:186136837-186136859 CTCGGGCACAGACAGGTGGACGG - Intronic
985107639 4:186514634-186514656 CTGGGAAAGAGACAAATGGATGG + Intronic
985779851 5:1864829-1864851 CAGGGTCAGAGCCAGGAGGAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987227524 5:15859086-15859108 CTGGGGCACAGACAATTGGATGG - Intronic
989012153 5:36885385-36885407 CAGGGGCCTGGCCAAGTGGATGG + Intronic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990756724 5:59079924-59079946 CAGGGGCAGAGGCAAGGGAAGGG + Intronic
992330964 5:75717194-75717216 CTGGGGAAGAGCCCAGGGGGAGG + Intronic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
994934517 5:106237252-106237274 CAGGTGGAGAGCCAAGGGGAAGG + Intergenic
995083871 5:108085693-108085715 GGGAGGCAGAGACAAGTGGATGG + Intronic
995456457 5:112357803-112357825 CTAGGGAAGAGCTATGTGGATGG + Intronic
996090898 5:119350856-119350878 CTGGGGCAGAACCATGTGAGAGG - Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
997413866 5:133710299-133710321 CTTGGGCTGAGCCTGGTGGAGGG - Intergenic
997593094 5:135087472-135087494 ATGGGGCAGAGCCTAGAGGCTGG - Intronic
998175461 5:139899183-139899205 CTGGAGCAGAGCCCTGTAGAGGG - Intronic
999082380 5:148856569-148856591 CTGGGCCAGAGGCCAGTGGCTGG + Intergenic
999093502 5:148958035-148958057 CTGGGACAGTGCCAGGTGAAAGG + Intronic
999380532 5:151118050-151118072 CTGGGACAGAGCTGAGGGGATGG - Intronic
999615085 5:153414520-153414542 ATGGGGCAGAACCCAGGGGAAGG - Intergenic
999779064 5:154834778-154834800 CGGGGGCAGAGCATAGGGGAAGG - Intronic
1000049434 5:157549071-157549093 TTTGGGCTGAGCCAAGAGGATGG - Intronic
1001897871 5:175396989-175397011 CTGGGGCAGAGCCAGCGGGACGG + Intergenic
1002005382 5:176228999-176229021 ATCGGGGAGAGACAAGTGGATGG - Intergenic
1002062463 5:176633922-176633944 CTGGGGCAGACTCCAGAGGAGGG + Intronic
1002220994 5:177681621-177681643 ATCGGGGAGAGACAAGTGGATGG + Intergenic
1002310423 5:178310508-178310530 CTGGGGCTAAGCCAGGTGAAGGG + Intronic
1002522493 5:179799459-179799481 CAGGGGCAGGGCCAAGGGGCAGG - Intronic
1002784613 6:392007-392029 CTCGGGCAGAGCCAAGGAGGCGG - Intronic
1003444893 6:6175350-6175372 GTGGGACAGGCCCAAGTGGAAGG - Intronic
1003790028 6:9535968-9535990 CTGAGGCAGAGGCAAGAGAATGG - Intergenic
1004184844 6:13413052-13413074 CAGTGGCAGAGCCAAGAGGGTGG - Intronic
1004187750 6:13435531-13435553 CTGGGGCAAACCCACCTGGAGGG - Intronic
1004324862 6:14665422-14665444 ATGGGGCAAAGCCGAGGGGATGG + Intergenic
1004529622 6:16441271-16441293 AGGGGGCAGATCCAAGTGAAGGG + Intronic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005809745 6:29506635-29506657 CTGGGGCACGGCCCAGAGGAGGG - Intergenic
1006088753 6:31615599-31615621 AGGGGGCAGAGCCAGGGGGATGG + Intronic
1006136062 6:31897205-31897227 CTGGGGCCGAGAGAAGAGGAGGG + Intronic
1006829735 6:36961602-36961624 CACAGGCAGAGCCAAGGGGAGGG + Intronic
1006854946 6:37126149-37126171 CTGGGGGAATGCTAAGTGGAAGG - Intergenic
1007215458 6:40234238-40234260 CTGTCGCAGAGCAAAATGGAAGG + Intergenic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012449946 6:99344360-99344382 CTCAGGCAGGGCCAAGGGGAAGG - Intronic
1014734423 6:125075590-125075612 CAAGGGCAGGGTCAAGTGGAGGG - Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1016797838 6:148136758-148136780 ATGGGACACAGCCAAGTCGAGGG - Intergenic
1016941280 6:149484705-149484727 CCGGGGCAGAGGCAGGAGGAGGG - Intronic
1017898518 6:158701618-158701640 CTGGGGCTGAGCGAAGGAGATGG + Intronic
1017905044 6:158752086-158752108 CTGGGGCAGAGTCCAGTGGATGG + Intronic
1020040411 7:4996949-4996971 CAGGAGGAAAGCCAAGTGGATGG - Intronic
1020113146 7:5459267-5459289 CTGGGGCTGAGCCAAGGCCAGGG - Intronic
1022388447 7:29923398-29923420 GGGGGGCAGAACCAATTGGAAGG - Intronic
1023937157 7:44748512-44748534 CCGGGGCGGGGCCGAGTGGAAGG - Intergenic
1024486446 7:49925680-49925702 CTGAGGCAGAGGCCTGTGGATGG - Intronic
1024874740 7:54009048-54009070 CTGGGGCAGGGCACAGAGGATGG - Intergenic
1024914122 7:54479859-54479881 CTGGAACAGAGGCAAGGGGAAGG + Intergenic
1027224392 7:76234882-76234904 CTGGTGCAGAGGGAAGCGGACGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027820720 7:83040564-83040586 CTGGGGAAGAGACAGCTGGAAGG - Intronic
1028477403 7:91266267-91266289 CTGGCGCTGGGCCAGGTGGACGG + Exonic
1029259704 7:99293510-99293532 CTGGGGCAGAGACAAGCTTAGGG - Intergenic
1029381650 7:100219379-100219401 CTGGGGCAGAGCCCAGTATGGGG + Exonic
1029401811 7:100351827-100351849 CTGGGGCAGAGCCCAGTATGGGG + Intronic
1029536970 7:101162871-101162893 CAGGGGCAGGGCCAAGGGGCAGG + Exonic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1031982269 7:128135728-128135750 CAGGGACCGAGCCAAGTGGAAGG + Intergenic
1032768421 7:135023409-135023431 CTAGGGAAGAGGCAAGTGAAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034406808 7:150909392-150909414 CTGAGGCAGAGGCAAGGGGCTGG + Intergenic
1034425822 7:151013565-151013587 CAGGGGCAGAGCCAAAGGGGCGG - Intronic
1034467865 7:151240310-151240332 CTGGGGCAGATCCAACAGGGAGG + Intronic
1034542076 7:151764717-151764739 CAGGGGCAGAGCCAGGAGGTGGG + Intronic
1034978974 7:155463713-155463735 CTGGGGCCAAGCCAAAAGGAGGG - Exonic
1035070398 7:156140485-156140507 CTGAGGCAGAGAGAAGGGGAAGG + Intergenic
1035160063 7:156943723-156943745 CTGGGGCGGGGACAGGTGGATGG + Intergenic
1035381842 7:158445572-158445594 CTGGGGCAGAGGCGAGGGGTGGG - Intronic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1035754969 8:2023980-2024002 CTGGGTCAGAGCCGAGGAGAGGG + Intergenic
1039005104 8:33027286-33027308 CTGGGGCAGAACCAAGTTGAAGG + Intergenic
1039442291 8:37603394-37603416 GTCGTCCAGAGCCAAGTGGATGG + Intergenic
1042162378 8:65910044-65910066 CTGGGGAAGATACATGTGGATGG - Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044433343 8:92134382-92134404 GTGGGACAGACCCAAGAGGAGGG + Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045520982 8:102903168-102903190 CAGGGACAGAGCCAAGTTTACGG + Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049178773 8:141209730-141209752 CTGTGGCAAGGCCATGTGGAGGG + Intronic
1049206642 8:141366700-141366722 CTGGGGCAGGGCCATGGTGAGGG - Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1052028661 9:23603843-23603865 CTGGGGAAGAGCGAAGGGGCGGG - Intergenic
1052129695 9:24828110-24828132 GTGGAGCAGAGCGGAGTGGAGGG - Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1053667523 9:40326478-40326500 CTGGAGCAGAGCCAATGAGAGGG - Intronic
1053751144 9:41256801-41256823 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1053917104 9:42951581-42951603 CTGGAGCAGAGCCAATGAGAGGG - Intergenic
1054256664 9:62821130-62821152 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1054334646 9:63794482-63794504 CGGGGGCAGAGGCAGGAGGATGG - Intergenic
1054517088 9:66049807-66049829 CTGGAGCAGAGCCAATGAGAGGG + Intergenic
1055604013 9:77949259-77949281 CTGGTGCAGAGGCAAGTTCAAGG + Intronic
1055888239 9:81091978-81092000 ATGGGGCAGAGCAACATGGAAGG + Intergenic
1056546052 9:87614865-87614887 GTGGGGGAAAGCCAAATGGAAGG - Intronic
1057199576 9:93133076-93133098 CTGGGGCAGGGCCAGGTCGCTGG + Intronic
1057304189 9:93902964-93902986 CTGGGACAGAGCCCAGCGGCTGG + Intergenic
1057875334 9:98749293-98749315 CTGAGGCAGTGCCATGGGGAGGG - Intronic
1058259175 9:102809056-102809078 TTGGGGAAGAGCTATGTGGATGG - Intergenic
1059051786 9:110934276-110934298 CTGTGGGAGAGCCATGTGGCAGG - Intronic
1059237140 9:112770587-112770609 CAGGGGGAGAGAGAAGTGGACGG - Intronic
1059737529 9:117117248-117117270 CTAGCTCAGATCCAAGTGGAAGG + Intronic
1059766613 9:117389566-117389588 CTGGGGAAGAGCTAAATGGCTGG - Intronic
1060591742 9:124821114-124821136 CTGGTGCTGAGCCATGAGGAAGG - Intergenic
1060875866 9:127083236-127083258 GTGGAGCAGAGCTAGGTGGAAGG - Intronic
1060973649 9:127753032-127753054 TACGGGCAGAGCCAAGGGGAGGG + Intronic
1061498247 9:130987908-130987930 ATGGAGCAGAGCCCAGGGGAGGG + Intergenic
1061924467 9:133799138-133799160 ATGTGGCAGAGCCACTTGGATGG - Intronic
1062048506 9:134435397-134435419 CTGGGGCAGGGACCAGTGGGGGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062146995 9:134995038-134995060 CAGGGACAGTGCCAAGTGAATGG + Intergenic
1062268973 9:135700141-135700163 CTTGGGCAGGGCCAGGTGAAGGG - Intergenic
1062606772 9:137352027-137352049 CTGGGGCAGCGCCCGGTGGTGGG - Intronic
1185433228 X:21449-21471 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185442430 X:233517-233539 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185648132 X:1629492-1629514 CTGGGGCTGAGCTCTGTGGATGG + Intronic
1187254298 X:17628213-17628235 CTGGAGCTCTGCCAAGTGGAAGG + Intronic
1188230464 X:27656795-27656817 ATGGGTCAAAGCCAAGGGGAAGG + Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188972918 X:36639110-36639132 CTGGGCAAGAGACATGTGGATGG + Intergenic
1189548887 X:42072588-42072610 GTGGGGAAGAGACAAGGGGAAGG + Intergenic
1189953918 X:46259296-46259318 CCGGGCCATAGCCAAGTGCATGG - Intergenic
1192240346 X:69323397-69323419 CTGAGGCAGAGGCAAGGTGAGGG + Intergenic
1195206286 X:102602668-102602690 CTGGAGAAGAGCCTAGTGTAGGG + Exonic
1195672172 X:107479032-107479054 CTTGGCCACAGCCAAGTGGGGGG - Intergenic
1196001980 X:110795941-110795963 CGGGGGCAGAGCCAAGGCGCGGG + Intergenic
1196093624 X:111774635-111774657 CTGGAGAAGAGCAAAATGGAGGG - Exonic
1196194232 X:112823094-112823116 CTGAAGAACAGCCAAGTGGAGGG - Exonic
1196402917 X:115334567-115334589 GTGGGGCCGAGGCAGGTGGATGG + Intergenic
1196733366 X:118963360-118963382 CTGGTGCAGAGCCCTGTGGCAGG - Intergenic
1196745811 X:119070880-119070902 CTGGTGCAGAGCCCTGTGGCAGG + Intergenic
1197744321 X:129920812-129920834 TTGGGGAAGAGCCATGAGGATGG + Intronic
1198239194 X:134766471-134766493 CAGGGTCAGAGCCAAGGAGATGG + Intergenic
1198364895 X:135930339-135930361 CTGGGGCAGAGCAAAGTTCAAGG + Intergenic
1198605403 X:138331931-138331953 CTGGGGTAAAGCCATGTGGATGG - Intergenic
1199094861 X:143726496-143726518 CCGGGGCCGATCCAAGTGCAGGG + Intergenic
1199970145 X:152853674-152853696 CTGGGGCAGAGCCATGAGGCGGG - Intronic
1200334582 X:155336000-155336022 ATGGGGCAAAGAGAAGTGGATGG - Intergenic
1201117836 Y:10848112-10848134 CTGGTGTGGAGTCAAGTGGAGGG - Intergenic