ID: 907328747

View in Genome Browser
Species Human (GRCh38)
Location 1:53657881-53657903
Sequence GAGGGTGCAGAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907328747_907328756 16 Left 907328747 1:53657881-53657903 CCTTGCCCCTTCTCTGCACCCTC No data
Right 907328756 1:53657920-53657942 CAGCCTCATCCTCTCAGCCTGGG No data
907328747_907328755 15 Left 907328747 1:53657881-53657903 CCTTGCCCCTTCTCTGCACCCTC No data
Right 907328755 1:53657919-53657941 TCAGCCTCATCCTCTCAGCCTGG 0: 1
1: 0
2: 7
3: 40
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907328747 Original CRISPR GAGGGTGCAGAGAAGGGGCA AGG (reversed) Intronic
No off target data available for this crispr