ID: 907330042

View in Genome Browser
Species Human (GRCh38)
Location 1:53664831-53664853
Sequence ATGCCAGGAGGTTTTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907330032_907330042 22 Left 907330032 1:53664786-53664808 CCAAGAGGCTGGTGGCTGAGCGA 0: 1
1: 0
2: 1
3: 14
4: 175
Right 907330042 1:53664831-53664853 ATGCCAGGAGGTTTTCTTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 201
907330036_907330042 -4 Left 907330036 1:53664812-53664834 CCTGAAGGAGCGAGGGAGCATGC No data
Right 907330042 1:53664831-53664853 ATGCCAGGAGGTTTTCTTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907330042 Original CRISPR ATGCCAGGAGGTTTTCTTGG GGG Intronic
903268607 1:22173906-22173928 ATGCCGGGAAGTTTTCTGGAAGG + Intergenic
903752499 1:25635258-25635280 AAGCCAAGAAGTTTTTTTGGGGG + Intronic
903996014 1:27306041-27306063 ATGCCAGGAGGTGTATATGGTGG - Intronic
905009960 1:34740496-34740518 ATGCAGGGAGGCTTTCTAGGGGG - Intronic
905866290 1:41378533-41378555 AGGCCTGGAGCTTGTCTTGGCGG + Intronic
906023776 1:42655590-42655612 ATACCAAGAGCTTTTCCTGGGGG + Intergenic
907330042 1:53664831-53664853 ATGCCAGGAGGTTTTCTTGGGGG + Intronic
907861012 1:58353088-58353110 GTGGCATGAGGGTTTCTTGGTGG - Intronic
907881335 1:58551741-58551763 ATGGTAGGAGGTTTGCTTGAAGG + Intergenic
907950786 1:59181690-59181712 ATGCCAGGAGCTATTCTAGAGGG - Intergenic
908114960 1:60931674-60931696 ATGTCAGGAGGACTTCTGGGAGG - Intronic
908506289 1:64804199-64804221 ATTCAAGGAAGGTTTCTTGGAGG - Intronic
908740573 1:67323159-67323181 GTGCCAGGTGATTTTCCTGGAGG + Intronic
909576717 1:77184466-77184488 AGGGCTGGAGGTTTTCTTGTGGG - Intronic
910094209 1:83501587-83501609 AAGCCAAAAGGTTTTGTTGGTGG + Intergenic
912158516 1:106952103-106952125 AGGAGAGGAGGTTTTCTTAGTGG - Intergenic
913044303 1:115060857-115060879 GTGCCAGGTGGTGTTCTAGGTGG - Intronic
915455139 1:156035583-156035605 AGGCCAGAAAGTTTTCTTTGAGG - Exonic
917019030 1:170566294-170566316 AGCCCAGGAGAATTTCTTGGAGG - Intergenic
917322512 1:173798229-173798251 GTGCCCTGAGGTTTTCTTGAAGG - Intergenic
917496063 1:175541116-175541138 ATGTCAGGACGTCTTCTCGGAGG - Intronic
917910683 1:179641916-179641938 ATTCAAGGTTGTTTTCTTGGGGG + Intronic
918436132 1:184515107-184515129 ATGCCAGGAGGTGTTCAAAGAGG - Intronic
922997696 1:229978671-229978693 GTTTCAGGAGGTTTTCTTGTTGG - Intergenic
1063068601 10:2636189-2636211 ATGCCAGGTCCTATTCTTGGTGG - Intergenic
1063945346 10:11170601-11170623 ATGCTAGGAAGTTCTCTCGGAGG + Intronic
1065753119 10:28906747-28906769 AATCCAGGATGGTTTCTTGGAGG - Intergenic
1068228117 10:54133620-54133642 ATGACAGGAGCTTTTCTTGAAGG + Intronic
1068959844 10:62855623-62855645 ATGCCAGAAGGGTTTATTGTTGG + Intronic
1069880008 10:71586205-71586227 ATGGCTGGAGGTTGTTTTGGTGG + Intronic
1070591881 10:77807381-77807403 ATGGCAGCAGGCTTTCTAGGAGG - Intronic
1070655073 10:78265824-78265846 ATGCCCTGAGGTGGTCTTGGAGG + Intergenic
1070689941 10:78517094-78517116 CTGCCAAGAAGTTTTCTTGATGG + Intergenic
1071304504 10:84286468-84286490 ATGCCCGGAGGTGTACTAGGTGG - Intergenic
1071676776 10:87662232-87662254 ATGCCAGGTGGTATACTGGGTGG + Intronic
1072907819 10:99471265-99471287 AAGGCAGGAGGATTGCTTGGGGG + Intergenic
1073377150 10:103045603-103045625 ATGACAGAGTGTTTTCTTGGTGG - Intronic
1076115786 10:127898387-127898409 GCGCCAGGAGGTTTTCAAGGAGG - Intergenic
1076865172 10:133163018-133163040 ATGCAAGGAGGGCTTCCTGGAGG + Intronic
1078058362 11:8026786-8026808 ATTCCAGCAGGTTTTTTGGGGGG - Intronic
1078178068 11:8985635-8985657 ATGACATGAGGTTTTGTTGGGGG + Intronic
1080791721 11:35527426-35527448 ATACCATGAGATGTTCTTGGGGG - Intronic
1081004272 11:37714789-37714811 ATCCTATGAGGTTTCCTTGGTGG + Intergenic
1086218554 11:84412861-84412883 ATTCCAGGAAGTTATCTTGGAGG - Intronic
1088802560 11:113319748-113319770 ATGCATGGAGGTTTTCGTGCTGG + Intronic
1089586139 11:119511026-119511048 ATGCAAGCAGGTATTTTTGGGGG + Intergenic
1089949860 11:122515583-122515605 ATGCAAGGAGTTTATCTGGGAGG + Intergenic
1090012502 11:123057792-123057814 ATGCCTGGGGGATTTCCTGGTGG - Exonic
1090012505 11:123057804-123057826 ATGCCAGGAGGAATGCCTGGGGG - Exonic
1091692332 12:2605614-2605636 ATGCCAGGAGCCTTTCCAGGAGG - Intronic
1093848358 12:24003759-24003781 ATGCCAGCAGGTTTTTTTTTTGG + Intergenic
1093964352 12:25309543-25309565 AAGGCTGGAGGTTTCCTTGGGGG - Intergenic
1094824459 12:34258508-34258530 ATTCCATGAGGATTTCTTGTAGG - Intergenic
1095086754 12:38064835-38064857 ATTCCATGAGGATTTCTTGCAGG + Intergenic
1097678673 12:62629020-62629042 CTTTGAGGAGGTTTTCTTGGAGG - Intergenic
1098971703 12:76863884-76863906 ATCCCAGGAGGTGCTTTTGGGGG - Intronic
1100270271 12:93017983-93018005 AAGGTAGGAGTTTTTCTTGGTGG + Intergenic
1100474714 12:94924740-94924762 ATGGAAAGAGGTTTCCTTGGGGG + Intronic
1100929999 12:99597171-99597193 GTGCCAGGAAGTCTTCTTAGTGG + Intronic
1101381157 12:104215262-104215284 AAGCCAGGTGGTTATCTGGGAGG + Intergenic
1102042768 12:109811144-109811166 AATCCAGGAGGGCTTCTTGGAGG - Intronic
1102443485 12:112982108-112982130 GTTCTAAGAGGTTTTCTTGGTGG + Intronic
1110084340 13:71358543-71358565 ATACCTGGATGTTTTCTTTGGGG - Intergenic
1113461410 13:110484925-110484947 ATGACAGGAGGTGGTCCTGGGGG - Exonic
1114696701 14:24632797-24632819 ATGCCAGGAGGTCTCCTTAGAGG - Intronic
1114775742 14:25479020-25479042 ATGGCAGGAGGTCTTATTGAGGG + Intergenic
1115163284 14:30419435-30419457 AAGCCAGGAGGAATGCTTGGGGG + Intergenic
1117657675 14:57973228-57973250 ATGCCAGGAAGTTTCTTTGTGGG + Intronic
1118602906 14:67482822-67482844 ATCCCAGGGGCTTTCCTTGGGGG - Intronic
1119118655 14:72052177-72052199 ATACCAGGAGGCTTTTTGGGGGG - Intronic
1121634233 14:95442955-95442977 ATGCCAGGCAGTGTTCTAGGTGG - Intronic
1126391106 15:48153586-48153608 AAGTCAGGAGGGTTTCTTTGGGG - Intronic
1127809795 15:62554858-62554880 ATGCCAGGAGTTCTCCTTGCAGG + Intronic
1128914744 15:71549649-71549671 CTGCCAGCTGGTTTTCTTGCAGG + Intronic
1129432329 15:75508824-75508846 ACGCCAGGAGGATTTTTTGAAGG + Intronic
1132587398 16:711595-711617 ATGCCAGGTGCTTTCCTGGGTGG + Intronic
1132951722 16:2566614-2566636 ACGCCAGCAGGTCTTCCTGGGGG + Intronic
1132962628 16:2633556-2633578 ACGCCAGCAGGTCTTCCTGGGGG - Intergenic
1135686957 16:24505517-24505539 ATGCCAGCTGATTTTCTGGGTGG + Intergenic
1135969579 16:27062598-27062620 CTGAGAGGAGGGTTTCTTGGGGG + Intergenic
1138073780 16:54020376-54020398 CTTCCAGTAGGTTTTCTTGCTGG + Intronic
1139930787 16:70524414-70524436 ATGCGATGATGTTTCCTTGGAGG + Intronic
1140692346 16:77496617-77496639 ATTCCAAGAGGTTTCTTTGGAGG + Intergenic
1141738543 16:85873061-85873083 ATCCCAGGATGTCTTCTGGGAGG + Intergenic
1141861184 16:86717701-86717723 AAGCCAGGAGGGCTTCATGGAGG + Intergenic
1142832297 17:2558229-2558251 ATACCAGGAGGGCTTCTTTGAGG + Intergenic
1143060508 17:4196760-4196782 ATGCTACAAGGTTTCCTTGGAGG + Intronic
1143780638 17:9226980-9227002 AAGCCAAGAGGCTTCCTTGGCGG + Intronic
1145912361 17:28550042-28550064 CTGCCAGGAGGGCTTCCTGGAGG - Intronic
1148764309 17:50028434-50028456 ATCACAGGGGGGTTTCTTGGGGG - Intergenic
1149604946 17:57917902-57917924 ATGCCAGCTGGCTTTTTTGGTGG + Intronic
1151078280 17:71299412-71299434 GTGCTGGGAGGTTTTCTTTGGGG - Intergenic
1151677014 17:75603794-75603816 ATGCCACCAGCTTTTCTTGGAGG - Intergenic
1151968331 17:77444049-77444071 ATGTCAGGAGGGCTTCCTGGAGG + Intronic
1153938551 18:9954630-9954652 ATGCCAAGAGGTATTCCTTGGGG + Intronic
1154437958 18:14361052-14361074 CAGCCAGGAGGCTATCTTGGGGG + Intergenic
1157198826 18:45641974-45641996 ATGCCTGGTGGTATTCTTGGGGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1159841626 18:73405051-73405073 ATACAAGTATGTTTTCTTGGAGG + Intergenic
1160403467 18:78628618-78628640 AGGCCAGGTGGTCTTCCTGGAGG - Intergenic
1161274451 19:3407856-3407878 ATGGCTGGAGGTTTCCTAGGAGG + Intronic
1162472497 19:10880829-10880851 CTCCCTGGAGGTTTTCGTGGAGG + Intronic
1163612284 19:18307857-18307879 AAGCCAGAAGGGTTTCCTGGAGG + Intronic
1166801138 19:45457961-45457983 AAGCCAGGAGGACTTCCTGGTGG - Intronic
1167442185 19:49514655-49514677 AAGCCAGGAGTTTGTCCTGGGGG - Intronic
926051386 2:9747000-9747022 ATGACAGGAGGTTTGCCTTGTGG - Intergenic
926734340 2:16061305-16061327 ATTCCAGAAGGTTTTCAAGGTGG - Intergenic
929516877 2:42611495-42611517 ATGACATGAGGTTTTCTATGGGG - Intronic
936588052 2:113775987-113776009 ATGCAAGGTGGTTTTTTTGGTGG + Intergenic
938770987 2:134500497-134500519 ATGCCAGATGGTTTTGCTGGTGG - Intronic
938891921 2:135714013-135714035 TTGCCTGATGGTTTTCTTGGTGG - Intronic
939709525 2:145499790-145499812 AAGCCAAAAGGTTTTTTTGGAGG - Intergenic
940191305 2:151042780-151042802 ATGCCATGAGATATTGTTGGAGG - Intronic
940404400 2:153284120-153284142 ATGCCTGGAGTTTTGCCTGGGGG + Intergenic
944680824 2:202075139-202075161 ATGCCAGGATGGCTTCTTTGAGG - Exonic
946111126 2:217418383-217418405 ATGCCAGTAGGTTGAGTTGGAGG - Intronic
946279616 2:218657416-218657438 ATGTCAGGAGGCCTTCATGGTGG - Intronic
947089261 2:226492464-226492486 ATTCCAGAAGTCTTTCTTGGTGG + Intergenic
948799304 2:240424287-240424309 ATGCCTGCAGGTTTTCTGGAAGG - Intergenic
1169268409 20:4181561-4181583 AGCCCCGGAGGTTTTCTTGCTGG - Intronic
1170181514 20:13535606-13535628 AGGCCAGGAAGTATTCTTGAAGG - Intronic
1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG + Intronic
1172028432 20:31965574-31965596 AAGCCAGGAGGGTTTCCTGAAGG + Intergenic
1174680821 20:52406537-52406559 TTGCCTGGCAGTTTTCTTGGAGG + Intergenic
1175457578 20:59127061-59127083 ATCCCAGGAGGTTTGCTTCTTGG + Intergenic
1177807504 21:25888664-25888686 AAGCCAGGAGGTATCCTTGCAGG - Intronic
1179937827 21:44616332-44616354 CTGCCAGGATGTTGCCTTGGGGG + Intronic
1182598646 22:31442104-31442126 ATGACAGGAGGTTTTCTGTGAGG + Exonic
1184257329 22:43294697-43294719 ATTCCAGGAGGACTTCCTGGAGG - Intronic
1184509740 22:44926449-44926471 ATGCCTGGAGGTTTTATCTGGGG - Intronic
1184920128 22:47600327-47600349 AGGCCAGGCTGTTTTCTGGGAGG + Intergenic
949413133 3:3787217-3787239 ATGTCAGGGGGTTTTCTCTGGGG + Intronic
949965633 3:9353784-9353806 GTCCCAAAAGGTTTTCTTGGGGG + Intronic
950147717 3:10663780-10663802 ATGCCAGGAAGGTGTCTGGGAGG - Intronic
951105262 3:18734819-18734841 ATACCAGGAGGCTTGCTTGTTGG + Intergenic
951770596 3:26252069-26252091 ATGCCCGGAGTTTTTGCTGGTGG - Intergenic
954068942 3:48128919-48128941 ATGCCAGGAGAAATGCTTGGAGG - Intergenic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
955136240 3:56221578-56221600 ATGACAGGATGTTTACATGGAGG - Intronic
956656561 3:71558419-71558441 ATGGCAGAAAGTTTTCTAGGAGG + Intronic
958647654 3:96892666-96892688 AACTCATGAGGTTTTCTTGGTGG + Intronic
958816917 3:98926791-98926813 GTGCCTGGAGGGTTTTTTGGGGG - Intergenic
959518188 3:107294233-107294255 ATCCCAGGAAGATTTTTTGGTGG - Intergenic
962689731 3:137882145-137882167 ATGCCAGGAGGAATGCCTGGGGG + Intergenic
963732050 3:148984466-148984488 AGGCCAGAAAGTTTTCTTTGAGG - Intergenic
965657190 3:170999997-171000019 ATGACAGGAAGTTTTGTGGGGGG - Intronic
966748690 3:183302047-183302069 ATGCCCAGAGGTTTTATTGGTGG - Intronic
966828607 3:183986715-183986737 ATGACAGAAGCTCTTCTTGGGGG + Intronic
968552648 4:1231564-1231586 ATGGCAGGAGGTGGGCTTGGCGG - Intronic
969299180 4:6287434-6287456 AAGCCAGGAGGTCATCCTGGAGG - Intronic
969378147 4:6776675-6776697 ATGCCAGGAGCTTTCCCTGAGGG + Intergenic
969542764 4:7803861-7803883 ATCCCAGGGGATTTTTTTGGGGG - Intronic
971148693 4:24007806-24007828 ATGCTAGGCGGGTTCCTTGGAGG + Intergenic
972384755 4:38554045-38554067 ATGCCAGGAGCTTAACCTGGAGG - Intergenic
972711200 4:41596893-41596915 ATCCCAGGATGTTTTCTTTCTGG - Intronic
973280498 4:48355269-48355291 GTGCCAGGAAGTTTTCTTTGGGG + Intronic
973299783 4:48568267-48568289 CTGCAATGAGGTTTTCTTTGAGG + Intronic
975280278 4:72553988-72554010 ATGACAACAGTTTTTCTTGGGGG - Intronic
979272240 4:118776351-118776373 ATGCCAGGAGGGCTTGTTGGTGG + Intronic
981702867 4:147626245-147626267 AGGCAAGGAGGTTTGCTTTGGGG + Intronic
983384603 4:167043351-167043373 ATTCCAGGAGGTTTTGTTTTAGG + Intronic
985205867 4:187536224-187536246 GTGCCAGGAGGTTGTGTCGGTGG - Intergenic
985248509 4:187999971-187999993 ATGGCAGGAGGTGAGCTTGGAGG + Intronic
987166518 5:15203700-15203722 ATTCAAGAAAGTTTTCTTGGGGG + Intergenic
988103480 5:26712014-26712036 GGGCCAGCAGGTTTTATTGGCGG - Intergenic
990900848 5:60747301-60747323 AAGCCAGCAGGATTTCTTGTTGG + Intergenic
991565572 5:68000899-68000921 ATCCCAGGAGATTGTCTTGAGGG - Intergenic
995585477 5:113643811-113643833 CTGTCAGGATGTTTTCTTGGGGG + Intergenic
997354556 5:133253969-133253991 ATCCCATGAGGTCATCTTGGAGG - Intronic
998615067 5:143731011-143731033 CTACCAGGAGGTTTCCCTGGTGG + Intergenic
1001477315 5:172059795-172059817 ATACCAGCAGCTTTGCTTGGGGG - Intronic
1002713519 5:181209946-181209968 ATGCAAGTAGTTTTTTTTGGGGG + Intergenic
1005258483 6:24030938-24030960 ATCTTAGGAGGTTTTCTTTGTGG - Intergenic
1005384452 6:25272280-25272302 ATGAAAGGAGGCTTTCTGGGTGG - Intergenic
1008522582 6:52376350-52376372 ATGCCAGGCTGCTTTCTGGGTGG + Intronic
1010543560 6:77122918-77122940 ATGCCTGGAGATCTGCTTGGAGG + Intergenic
1012609295 6:101196093-101196115 GTGCAAAGAGATTTTCTTGGTGG + Intergenic
1012932458 6:105331313-105331335 ATGCTAGGAGATTTTGTTGGGGG - Intronic
1013921773 6:115414471-115414493 AAGGCAGGAGGATTTCTTGAGGG - Intergenic
1016636711 6:146301147-146301169 ATTCAAGTAGGATTTCTTGGTGG - Intronic
1017385325 6:153876187-153876209 ATCCCAGGACTTTTTCTTGCAGG - Intergenic
1019493222 7:1324643-1324665 ATGCCAGGAGTTCTCCCTGGAGG + Intergenic
1019518129 7:1448496-1448518 ATGCCAGGGGCCATTCTTGGGGG + Intronic
1025716181 7:63958203-63958225 ATGCCTGTAGATTTTCCTGGAGG + Intergenic
1027139979 7:75650067-75650089 AAGCCAGGTGTTTTTCTTAGGGG - Intronic
1027967406 7:85029616-85029638 ATGCCAGGGGGATTTCCTGGTGG + Intronic
1034001608 7:147419325-147419347 CTGCCAGGAGGCTTTGGTGGTGG - Intronic
1035583208 8:753127-753149 AAGCCAGGAGGGTTTACTGGTGG + Intergenic
1036884655 8:12542865-12542887 TTGCTAGGAGGTTATCTTGCTGG + Intergenic
1037058168 8:14471007-14471029 ATGAAAGCAGGTTTTCTTGATGG - Intronic
1037549381 8:19955673-19955695 ATTTCAGGAGATATTCTTGGTGG - Intronic
1039254980 8:35709169-35709191 ATGCTAGGAGGTGTTCTGGGTGG + Intronic
1042096912 8:65226266-65226288 ATGGAGGGAGGTTTTGTTGGAGG + Intergenic
1042376965 8:68062610-68062632 ATGCCAGGAGCCTTTCTAAGTGG + Intronic
1045919669 8:107514547-107514569 AGGCCAAGAGGATTTCCTGGCGG + Intergenic
1047451064 8:124965390-124965412 ATGGCAGAAGGTTTTCTGGGTGG - Intergenic
1049584757 8:143427775-143427797 AGGGCAGGAGGTGTCCTTGGTGG - Intronic
1050251873 9:3753315-3753337 ATGCCAGCAGATTCTCTGGGTGG - Intergenic
1056497904 9:87178192-87178214 ATGCCATCAGGTTCTGTTGGGGG - Intergenic
1056674859 9:88666546-88666568 ATGCCAGGAGCAATTCTGGGAGG - Intergenic
1057718256 9:97512814-97512836 ATTTAAGGAAGTTTTCTTGGGGG + Intronic
1058729498 9:107836377-107836399 AAGACTGGAAGTTTTCTTGGAGG - Intergenic
1060736135 9:126067533-126067555 ATCCCAGGAGGCCTTCCTGGAGG - Intergenic
1061389888 9:130311612-130311634 ATCCCAGGAAGACTTCTTGGAGG + Intronic
1062330557 9:136041627-136041649 ATGCCAAGGGGTTTCTTTGGGGG + Intronic
1062632565 9:137471828-137471850 ATCTCAGGAGGTTTTCTTTTTGG + Intronic
1185930656 X:4199623-4199645 AGGACAGCAGGGTTTCTTGGAGG - Intergenic
1186262338 X:7792605-7792627 ATGCCAGGAGGATTAATAGGTGG + Intergenic
1186370067 X:8937525-8937547 AGACCAGGAGATTCTCTTGGAGG - Intergenic
1187888772 X:23913899-23913921 ATGCCAGGAGTTTACCTGGGTGG - Intronic
1188693277 X:33156534-33156556 ATGGCAGGAAGATTTATTGGGGG + Intronic
1188910663 X:35843116-35843138 TTGCCAGAAGATTTTCTTGCTGG - Intergenic
1189794437 X:44633847-44633869 ATGGCGGCTGGTTTTCTTGGTGG + Intergenic
1193359310 X:80561604-80561626 ATACCTGGAGGTACTCTTGGTGG - Intergenic
1194871965 X:99143326-99143348 CTGCCATGATGGTTTCTTGGTGG - Intergenic
1195082804 X:101386910-101386932 AAGCCTGGAGGTTTTCTCAGGGG + Intronic
1195437133 X:104857571-104857593 TTGCTAGGATGTTTTCTTGCTGG + Intronic
1196980074 X:121203149-121203171 ATGCCAGGAGGAATGCCTGGGGG - Intergenic
1201711154 Y:16993862-16993884 AGGACAGCAGGGTTTCTTGGAGG - Intergenic