ID: 907331927

View in Genome Browser
Species Human (GRCh38)
Location 1:53677235-53677257
Sequence TTTTGTTCGTTGGTGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907331927_907331934 19 Left 907331927 1:53677235-53677257 CCACTTTTCACCAACGAACAAAA No data
Right 907331934 1:53677277-53677299 TCCTTCCATGAAGGACCAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 148
907331927_907331933 10 Left 907331927 1:53677235-53677257 CCACTTTTCACCAACGAACAAAA No data
Right 907331933 1:53677268-53677290 CAGAAAGGCTCCTTCCATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 177
907331927_907331931 -5 Left 907331927 1:53677235-53677257 CCACTTTTCACCAACGAACAAAA No data
Right 907331931 1:53677253-53677275 CAAAATTGGTGGAACCAGAAAGG No data
907331927_907331936 20 Left 907331927 1:53677235-53677257 CCACTTTTCACCAACGAACAAAA No data
Right 907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907331927 Original CRISPR TTTTGTTCGTTGGTGAAAAG TGG (reversed) Intronic
No off target data available for this crispr