ID: 907331936 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:53677278-53677300 |
| Sequence | CCTTCCATGAAGGACCAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907331930_907331936 | 10 | Left | 907331930 | 1:53677245-53677267 | CCAACGAACAAAATTGGTGGAAC | No data | ||
| Right | 907331936 | 1:53677278-53677300 | CCTTCCATGAAGGACCAGCAGGG | No data | ||||
| 907331927_907331936 | 20 | Left | 907331927 | 1:53677235-53677257 | CCACTTTTCACCAACGAACAAAA | No data | ||
| Right | 907331936 | 1:53677278-53677300 | CCTTCCATGAAGGACCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907331936 | Original CRISPR | CCTTCCATGAAGGACCAGCA GGG | Intronic | ||
| No off target data available for this crispr | |||||