ID: 907331936

View in Genome Browser
Species Human (GRCh38)
Location 1:53677278-53677300
Sequence CCTTCCATGAAGGACCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907331930_907331936 10 Left 907331930 1:53677245-53677267 CCAACGAACAAAATTGGTGGAAC No data
Right 907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG No data
907331927_907331936 20 Left 907331927 1:53677235-53677257 CCACTTTTCACCAACGAACAAAA No data
Right 907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907331936 Original CRISPR CCTTCCATGAAGGACCAGCA GGG Intronic
No off target data available for this crispr