ID: 907332785

View in Genome Browser
Species Human (GRCh38)
Location 1:53682169-53682191
Sequence GCGGCTGTGTAGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907332785 Original CRISPR GCGGCTGTGTAGAGGCAGAG GGG (reversed) Intronic
900975031 1:6011501-6011523 GCAGATGTGCAGGGGCAGAGGGG + Intronic
901162720 1:7192374-7192396 GCAGCTGCGGAGGGGCAGAGCGG + Intronic
901208728 1:7512507-7512529 GTGGCTGTGTCCAGGCTGAGGGG + Intronic
902696362 1:18143369-18143391 GGGACTGTCTAGAGGAAGAGCGG - Intronic
904392073 1:30192546-30192568 GTGGCTGTGGAGAAGCAGAAAGG - Intergenic
905297457 1:36963159-36963181 GCTCCTGTGGAGAGGCAGATGGG - Intronic
905581088 1:39082838-39082860 AGGGCTGTGTAGAGACAGCGAGG - Intronic
907220955 1:52906608-52906630 GCTGCTGTGGAGAGGAAGAAAGG + Exonic
907332785 1:53682169-53682191 GCGGCTGTGTAGAGGCAGAGGGG - Intronic
907831981 1:58073344-58073366 GAGGGTGGGTAGAGTCAGAGAGG - Intronic
908051898 1:60242276-60242298 GGGGCTGTGCAGACACAGAGAGG - Intergenic
908123645 1:61008702-61008724 GCAGCTGGGGTGAGGCAGAGGGG + Intronic
911663782 1:100532144-100532166 GCACATGTGTAGGGGCAGAGAGG + Intergenic
912250735 1:108010220-108010242 GCGGGTGGGAAGAGGGAGAGAGG - Intergenic
912584589 1:110750830-110750852 GAGGCAGTGCAGAGTCAGAGAGG + Intergenic
912834437 1:112983408-112983430 GGTGGTGTGTAGTGGCAGAGAGG - Intergenic
915106863 1:153540200-153540222 GCAGCTCTGTAGAGGGAGAGGGG + Exonic
915263963 1:154701506-154701528 GCTGCTCTGTAGAGAAAGAGGGG + Exonic
917497080 1:175550299-175550321 TTGGCTGGGTAGGGGCAGAGAGG - Intronic
918009480 1:180573001-180573023 GCAGCTGTGCAGGGGCAGAGTGG - Intergenic
919945956 1:202319047-202319069 GCCATTGTGTAGAGCCAGAGGGG + Exonic
920497865 1:206468273-206468295 GAGGCTGTGAAAAGGGAGAGAGG - Intergenic
922359693 1:224810271-224810293 GTGGCCCTGTAGTGGCAGAGTGG + Intergenic
922699569 1:227750898-227750920 GAGACTGTGTAGAGGGAGATTGG + Intronic
923042892 1:230332657-230332679 GCGGCTGTGTGGAAGCAGCGGGG - Intronic
1062979768 10:1712465-1712487 GAGGCTGTGTGGAAGCACAGGGG + Intronic
1063189563 10:3680597-3680619 GCTGCTGTGTACAAGGAGAGTGG - Intergenic
1066332308 10:34438031-34438053 GAGGCTTTGTAGAGGGAGTGAGG - Intronic
1067158899 10:43806145-43806167 GAGGCAGGGTAGAGGCAGGGTGG - Intergenic
1067194578 10:44105243-44105265 GGGGCTGGGTAGAGGCAAAGTGG + Intergenic
1067617878 10:47768629-47768651 GGGGCTGTGCTGAGGTAGAGAGG + Intergenic
1067820700 10:49527086-49527108 GCTGCTGTGGACAGGCAGAGTGG + Intronic
1068057718 10:52031971-52031993 GCTGGAGTGTAGAGGGAGAGGGG + Intronic
1068129183 10:52876172-52876194 GAGGCTATGTAGAGAGAGAGAGG - Intergenic
1069700293 10:70419752-70419774 GAGCCTGTTTACAGGCAGAGAGG + Intronic
1069757890 10:70785042-70785064 GCGGCTGTAGAGAGGCTGACAGG + Intronic
1069814664 10:71186295-71186317 GGGGCTGGATAGAAGCAGAGTGG - Intergenic
1069939938 10:71948451-71948473 GCTGCTGTTTTGGGGCAGAGTGG - Intergenic
1070010246 10:72466513-72466535 TCTGCTTTGTAGAGGCAAAGCGG + Intronic
1070649959 10:78228260-78228282 GAGGCTTTGTGAAGGCAGAGTGG + Intergenic
1073977796 10:109119983-109120005 GAGGATGTGTATAGGCAGAGTGG - Intergenic
1075224719 10:120617969-120617991 CTGGCTGTGTACAGGGAGAGAGG + Intergenic
1075633650 10:124016177-124016199 GGGGCTGGCCAGAGGCAGAGGGG + Intronic
1075677139 10:124303561-124303583 GAGGCACTGTAGAGGCAGGGAGG - Intergenic
1076462567 10:130656626-130656648 GGTTCTGTGTGGAGGCAGAGTGG + Intergenic
1076648325 10:131969797-131969819 GCGGTGGTGAAGAGCCAGAGCGG - Intronic
1076754832 10:132563924-132563946 GCGGCTGAGTCAGGGCAGAGCGG + Intronic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077992193 11:7422176-7422198 GCGGCTGTGGAGAGGCAGAGAGG + Intronic
1078930108 11:15906078-15906100 TCGGCTGTGTGGAGTCACAGAGG - Intergenic
1079907210 11:26263541-26263563 GAGGCTGTGGAAAAGCAGAGAGG - Intergenic
1080448656 11:32360439-32360461 GGGGCTGGGGAAAGGCAGAGTGG - Intergenic
1080821982 11:35816100-35816122 GCGGAGGAGTAGAGGCAGGGTGG - Exonic
1083229456 11:61306664-61306686 GCATCTGAGAAGAGGCAGAGCGG - Intronic
1083647925 11:64183888-64183910 GCTGCTGTGTGGAGGAAGAGGGG - Intergenic
1086157716 11:83686119-83686141 GCTGCTGTGTGGAGGAAGGGTGG - Intronic
1087271877 11:96120291-96120313 ACAGCTGAGTAGAGGCAGAGAGG + Intronic
1089004983 11:115083825-115083847 GAGGCAGTGTGGAGGCACAGTGG - Intergenic
1089314836 11:117584297-117584319 GGGGCTGGGTGGAGGCAGATGGG - Intronic
1091804423 12:3345842-3345864 GAGGCTGTCTAGATGGAGAGAGG - Intergenic
1092138715 12:6167887-6167909 GTGGCGGTGGAGAGGCGGAGAGG + Intergenic
1094322395 12:29199652-29199674 GCAGCAGTGTGGAGGCAGAATGG + Intronic
1095049127 12:37541535-37541557 GCGGCTGTGCGGCGGCAGGGGGG - Intergenic
1096789169 12:54034481-54034503 GAGGCTCTTTAGAGGCAGCGGGG + Exonic
1097285397 12:57873350-57873372 GCGTATGTGTAGAGGTTGAGAGG + Intergenic
1100266025 12:92977465-92977487 TCTGGTGTGGAGAGGCAGAGAGG + Intergenic
1101353729 12:103957100-103957122 GCGCGTGTATAGAGGCAGAGAGG - Exonic
1101575108 12:105990147-105990169 GGGGCTGTGGTGAGGGAGAGAGG - Intergenic
1101866098 12:108520714-108520736 GCTGCTATTTAGAGTCAGAGAGG + Exonic
1103318084 12:120073201-120073223 ACTGCTGTGATGAGGCAGAGGGG + Intronic
1103827847 12:123754231-123754253 GGAGCTGGGTAGTGGCAGAGTGG + Intronic
1104138573 12:125963956-125963978 GGGGCTGTGTTGAGGGACAGTGG - Intergenic
1105613319 13:21988469-21988491 GCGTCTGTATAGTGGCAGACAGG + Intergenic
1107646556 13:42500015-42500037 GCCTCTGTGTGGAGACAGAGAGG - Intergenic
1108556833 13:51601714-51601736 GCAGCTAGGAAGAGGCAGAGTGG + Intronic
1111501436 13:89126059-89126081 GAGGCTGTGGGGAAGCAGAGAGG + Intergenic
1113468922 13:110530743-110530765 GTGTCTGTGTAGAGGTGGAGCGG - Intronic
1113473337 13:110561946-110561968 CCGGCTGTGCAGAAGCGGAGGGG - Intergenic
1113669702 13:112167403-112167425 GTGGCTTTTGAGAGGCAGAGGGG + Intergenic
1114492480 14:23112113-23112135 GATGCTGGGAAGAGGCAGAGAGG - Intergenic
1117255524 14:53973289-53973311 GCGGCTGTGGTGAGGGGGAGGGG + Intergenic
1117764037 14:59061358-59061380 GAGGCTGTGGGGAGACAGAGTGG - Intergenic
1119649613 14:76374426-76374448 GGGGCTGTGGAGAGGAACAGAGG + Intronic
1120613697 14:86675225-86675247 GGCTCTGTGTAGGGGCAGAGGGG + Intergenic
1121585640 14:95061273-95061295 GAGGCTGTGTGAAGACAGAGAGG - Intergenic
1122606211 14:102948619-102948641 GTGGCTGTGGAGAGGGGGAGTGG + Intronic
1124867197 15:33504025-33504047 GCGAATGTGGAGAGGCTGAGAGG + Intronic
1129785332 15:78306470-78306492 GGGGTTGTATAGAGGGAGAGAGG - Intergenic
1130031890 15:80322978-80323000 GTGGCTGTCTGGAGACAGAGTGG - Intergenic
1130357746 15:83149820-83149842 TAGGCTGTTTATAGGCAGAGGGG + Intronic
1130795273 15:87202140-87202162 GTGCTTGTGTAGGGGCAGAGGGG - Intergenic
1133021309 16:2968102-2968124 GCGCCTGTGTAGGGGCAGCTCGG + Exonic
1133445868 16:5860520-5860542 GTGGCTGTGTAGAGGAGAAGGGG + Intergenic
1134183215 16:12063927-12063949 GCGGCAGTGTAGATGCAGGCAGG + Intronic
1135229342 16:20691107-20691129 GCAGCTGTGAAGGGGCAGGGTGG + Exonic
1135389336 16:22076437-22076459 GCTGGTGGGTAGAGGCAGGGAGG + Intronic
1136404537 16:30036544-30036566 GCTGCTCTGTAGAGGCAGTTGGG + Intronic
1136568850 16:31085021-31085043 GCGCCTGTGCAGAGGCAGTGTGG + Exonic
1136591972 16:31223064-31223086 GCGGCAGTCCAGAGGCAAAGGGG - Intronic
1137044235 16:35641406-35641428 GCTGCAGGGTAGAGGCAGAGTGG + Intergenic
1138342932 16:56302529-56302551 GCTGCTGTGTATAGCCAGATGGG - Intronic
1140035713 16:71369755-71369777 GAGGCTTTGTAGAGTCAGACGGG - Intronic
1140945503 16:79764716-79764738 CAGGCTGTGTGGAGGCACAGGGG - Intergenic
1141302276 16:82828171-82828193 GGAGCTGTGTTGAGGAAGAGAGG + Intronic
1141582673 16:85011169-85011191 GCGGCGGGGTGGAGACAGAGCGG + Intronic
1142110792 16:88329976-88329998 GTGCCTGGGTACAGGCAGAGTGG + Intergenic
1143767641 17:9148084-9148106 GGGGCTGGGTAGGGGCAGAGGGG + Intronic
1145004179 17:19328264-19328286 CAGGCTCTGTAGAGGCACAGAGG - Intronic
1145907528 17:28524561-28524583 GGGGCTGTGTGGGGGCAGTGAGG - Exonic
1148972191 17:51493298-51493320 CCTGCTGTGTAGGGGCAGTGTGG + Intergenic
1150508566 17:65724856-65724878 GGGGCTGTGCAGTGGAAGAGGGG - Intronic
1152035340 17:77868795-77868817 GTGTGTGTGTAGGGGCAGAGTGG + Intergenic
1152287679 17:79422161-79422183 GCTGCTCTGGAGAGGCAGAAGGG + Intronic
1152718813 17:81912523-81912545 GTCGCTGTGCAGAAGCAGAGAGG - Exonic
1154312471 18:13277869-13277891 GTGACTGAGTGGAGGCAGAGGGG + Intronic
1157575324 18:48739531-48739553 GTGACTGGGAAGAGGCAGAGAGG - Intronic
1157612197 18:48964059-48964081 AAGGCTGTGTGGAGGCGGAGAGG - Intergenic
1161091122 19:2360458-2360480 GGGGCTGTGTAGAGGTGGCGTGG + Intergenic
1161124956 19:2550690-2550712 GGGGCTGGCCAGAGGCAGAGCGG - Intronic
1161388406 19:4008776-4008798 GGGGCTGTGTAGGGGGAGGGTGG - Intronic
1161699307 19:5786306-5786328 GCAGCTGCGTTGCGGCAGAGGGG - Intronic
1162032787 19:7924720-7924742 GCGGCTGTGTCGAGGATGCGTGG - Exonic
1163475439 19:17523337-17523359 GCGGCTGTGCAGGGTGAGAGTGG + Exonic
1163620889 19:18359348-18359370 TGGGGTGAGTAGAGGCAGAGCGG - Intronic
1164575725 19:29404334-29404356 GTGGCTGTGGACAGGCAGAGAGG + Intergenic
1164813488 19:31176261-31176283 GAGGCTGTGTAGGGGAGGAGGGG + Intergenic
1165071375 19:33256675-33256697 GTGGCTGTGTCAAGCCAGAGCGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165741122 19:38205932-38205954 TCGGTTGTGGAGAGGCAGAGTGG + Intronic
1166366336 19:42280361-42280383 GGGGCTGTGTAGAAGCGGACTGG + Intronic
1166421647 19:42640552-42640574 GGGGAGGTGGAGAGGCAGAGGGG + Intronic
1166927524 19:46279122-46279144 TTGGCTGTGTAGGGGCAAAGAGG - Intergenic
1167615822 19:50532518-50532540 GAGCCTGTGCAAAGGCAGAGAGG - Intronic
1168063796 19:53908477-53908499 GCGGCGGTGATGAGGGAGAGAGG - Intergenic
1168465136 19:56595522-56595544 GCGGCCGAGGAGAGGCTGAGGGG + Intronic
1202693094 1_KI270712v1_random:105050-105072 GCGGCGGCGGAGAGGCGGAGAGG + Intergenic
925005924 2:443065-443087 GTGGCTGTGTAGGGGCAGTGTGG - Intergenic
925747091 2:7052526-7052548 AGGGCTCTGTAGAGGCAGCGAGG + Intronic
926299120 2:11589642-11589664 GCGGCTATGTGGAGTCAGATGGG + Intronic
926885041 2:17589417-17589439 GCAGCTGTGCAGAAGGAGAGTGG + Intronic
927188581 2:20500139-20500161 GGGGCTGTGGACAGGCAGAGGGG + Intergenic
927466137 2:23338097-23338119 GCTGGTGTGGAGAGGGAGAGTGG + Intergenic
928918736 2:36503192-36503214 GCTGCTGTGCAGAGCCTGAGAGG - Intronic
930311747 2:49750517-49750539 GCGGCTGTTTAGAGGAAGAAGGG - Intergenic
931868429 2:66434994-66435016 GCCGCACTGGAGAGGCAGAGAGG - Intronic
932026182 2:68135593-68135615 GCTGCTTTGTAGAAGCAGTGGGG + Intronic
937338534 2:121076498-121076520 GCAGGTCTGGAGAGGCAGAGAGG + Intergenic
937463566 2:122110195-122110217 TCAGATGCGTAGAGGCAGAGAGG + Intergenic
937691731 2:124763552-124763574 GCAGCAGGGTAGGGGCAGAGAGG - Intronic
938301778 2:130219793-130219815 GAGGCTGTGCAGAGGCAGTTTGG - Intergenic
941974498 2:171387965-171387987 GCTGCTGGGAAGAGGGAGAGTGG - Intronic
942222487 2:173784200-173784222 GCGGCCCTGTAGAGGCTGGGGGG + Intergenic
946449290 2:219766051-219766073 GAGGCTGTTTAGAGGAAGACGGG - Intergenic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
948288856 2:236809125-236809147 GAGGCTGTGGAGAGGCAGGGTGG + Intergenic
948433197 2:237933832-237933854 GAGGCAGGGGAGAGGCAGAGAGG - Intergenic
948796599 2:240406103-240406125 GGGGCTGTGCAGAGGCTGTGGGG - Intergenic
1168772116 20:421932-421954 GCGGCAGTATGGAGGCAGGGTGG + Intronic
1172842430 20:37909920-37909942 GTGGCAGTGGGGAGGCAGAGAGG + Intronic
1173361835 20:42351608-42351630 GTTGCTGTCTAGTGGCAGAGGGG + Intronic
1174353963 20:49986230-49986252 GCTGCTGAGTAATGGCAGAGTGG + Intronic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1180182162 21:46122965-46122987 GCAGCTGGGCAGAGGCAGGGAGG + Intronic
1180993958 22:19955316-19955338 GCGCCTGTGGACAGGCTGAGAGG - Intronic
1181477880 22:23180038-23180060 GCGGCGTGGTAGGGGCAGAGGGG + Intronic
1182481841 22:30614299-30614321 GCTGCTGGGTGGGGGCAGAGAGG + Intronic
1184263334 22:43332438-43332460 GAGTCCGTGTAGAAGCAGAGGGG + Intronic
1184735483 22:46395340-46395362 TCGGCTGTGTGGAGGCCGTGGGG - Intronic
1184920220 22:47600661-47600683 GGGGGTGTGCAGAGGCTGAGGGG - Intergenic
1185305489 22:50113079-50113101 GAGGTTGTGGAGAGGCAGGGAGG + Intronic
949370799 3:3332792-3332814 GCTGCTATGTAGAGGCAGGTAGG + Intergenic
949536859 3:5003016-5003038 ACTGCTGTGAAGAAGCAGAGCGG - Intergenic
952890501 3:38037164-38037186 GAGGCTGTCTAGAGGCAGGGTGG + Intergenic
952924125 3:38308935-38308957 GTGGCTGTGCAGAGGCCAAGAGG - Exonic
954493280 3:50928302-50928324 GGGGCTGGGTAGAGGGAGAATGG - Intronic
961555316 3:127693038-127693060 TCGGCAGTCTAGAGGCAGAAGGG - Intronic
961565426 3:127760299-127760321 CCTGCTGGGTGGAGGCAGAGTGG - Intronic
961594271 3:128004859-128004881 GGGGCTGGGTAGAGGCAGGCTGG - Intergenic
961647951 3:128402523-128402545 ACGGCTATTTACAGGCAGAGCGG - Intronic
962302212 3:134252399-134252421 GAGGCTGAGAAGAGGAAGAGGGG + Intergenic
962811486 3:138962404-138962426 GAGGGTGTGGAGAGACAGAGAGG + Intergenic
963246198 3:143065693-143065715 GCTGCTGTGCAGAGACAGAATGG + Intergenic
965762572 3:172094810-172094832 GCGGGTGTGTAGTGGCTTAGTGG + Intronic
966350838 3:179032018-179032040 GAGGCTGTGTGGAGGGGGAGGGG - Intronic
967440831 3:189506677-189506699 GAGGCTGTGAAATGGCAGAGGGG + Intergenic
970212723 4:13727943-13727965 GGGGCTGTGTGGAAGCTGAGTGG + Intergenic
972006546 4:34115316-34115338 GTGTCTGTGTAGAGACAGGGAGG - Intergenic
973663263 4:53130581-53130603 GTGTGTGTGTAGAGGGAGAGGGG - Intronic
974385863 4:61201519-61201541 GTGGCTGTGTAGCGGAAGAAAGG + Intronic
974761745 4:66285397-66285419 GCGGGGGTGTAGGGGCAGTGTGG + Intergenic
975547315 4:75573251-75573273 GCAGGTGAGTAAAGGCAGAGTGG - Intergenic
981758066 4:148162736-148162758 GCAGCAGTGGTGAGGCAGAGAGG + Intronic
983554808 4:169050520-169050542 GCTGCTGTGCAGAGCAAGAGTGG + Intergenic
983644636 4:169977379-169977401 GAGGCTGGGAAGAGGAAGAGAGG + Intergenic
985192386 4:187389912-187389934 GCGGCTGCAGAGAGGCAGAAAGG + Intergenic
985484172 5:139656-139678 CCGGCTGGGAAGAGGCACAGAGG + Intergenic
985697192 5:1347244-1347266 CCAGCTGTGCAGTGGCAGAGAGG - Intergenic
985786884 5:1900616-1900638 GCAGATGTGGAGAGGCAGGGAGG - Intergenic
986545744 5:8894880-8894902 GGTGCTGTGTAGAGGCTCAGAGG - Intergenic
993041495 5:82819689-82819711 GTGGCTGTGGACAGGCAAAGAGG + Intergenic
994253091 5:97560051-97560073 GCAGCTATGTAGAAGCAGAGTGG + Intergenic
996396706 5:123021084-123021106 GGAACTGTGTGGAGGCAGAGAGG - Intronic
997233106 5:132257837-132257859 GCGGCTGCGTGGCGGCAGGGCGG + Intronic
1001211212 5:169811828-169811850 GGCGATGTGTAGATGCAGAGTGG - Intronic
1001301449 5:170536638-170536660 GCAGGTGTGTGGGGGCAGAGTGG - Intronic
1002898522 6:1392796-1392818 GCCGCTGGGTAGGGGCACAGAGG - Intronic
1003592165 6:7445575-7445597 GCGGTTGTGTAGCTGTAGAGAGG + Intergenic
1004318148 6:14609745-14609767 ACGGCTCTGTAGAGTCAGGGAGG + Intergenic
1005072221 6:21872287-21872309 GAGGCTTTGTAGGGGCAGAAAGG - Intergenic
1006388973 6:33747632-33747654 GAGGCTGTGCAGAGGCCCAGAGG + Intergenic
1007116205 6:39345091-39345113 CCTGCTGTGCAGAGGCACAGGGG - Intronic
1007168044 6:39842186-39842208 GCGTGTGGGGAGAGGCAGAGTGG - Intronic
1018744860 6:166754360-166754382 GAGCCTGTCTGGAGGCAGAGGGG + Intronic
1019007568 6:168813570-168813592 TTGACTGTGAAGAGGCAGAGGGG + Intergenic
1019500004 7:1360080-1360102 GGGGCTCAGCAGAGGCAGAGAGG - Intergenic
1019685660 7:2380557-2380579 TCGGCTGTGTACAGGCACCGTGG - Exonic
1020204626 7:6105165-6105187 GCGGCTGTGTAGGGGGAGGCGGG - Intronic
1020610036 7:10384305-10384327 ATGACTGTGTAGAGGCATAGAGG - Intergenic
1022335102 7:29414786-29414808 GATGCTGTGTAAAGGCTGAGAGG - Intronic
1022902946 7:34828253-34828275 GAGTGAGTGTAGAGGCAGAGTGG + Intronic
1023989790 7:45121886-45121908 GCTGATGTGTACAGGAAGAGAGG - Intergenic
1024318540 7:48043426-48043448 GCGTCTGTGTAGGGGCGGCGGGG + Intronic
1025078366 7:55962753-55962775 GCGGGGCTGCAGAGGCAGAGAGG - Intronic
1025295032 7:57770108-57770130 GCGGCTGTGCAGCGGCAGGGGGG - Intergenic
1026598705 7:71755121-71755143 GTGGCTGTCTGGAGGCTGAGAGG + Intergenic
1028290360 7:89057661-89057683 GAGGCTGAGTAGAGGCAGAAAGG + Intronic
1029203717 7:98855814-98855836 GTGGCTGTGCAGTGGCTGAGCGG - Intronic
1034433959 7:151054289-151054311 AGGGCTGTGGAGAGGCAGGGAGG + Exonic
1034456726 7:151174684-151174706 GCGGCTGAGGAGAAGCGGAGAGG - Intronic
1034879194 7:154750612-154750634 GCGGAAGGGAAGAGGCAGAGAGG - Intronic
1035470647 7:159106751-159106773 GAGGCTGGGTAGGGGCAGAGAGG + Intronic
1036743911 8:11390695-11390717 GAGGCTGGGCAAAGGCAGAGGGG + Intronic
1040795119 8:51281821-51281843 GCTGCTGCGTAGGGGCTGAGTGG + Intergenic
1041528364 8:58834684-58834706 GCTGCTGTGGAGCAGCAGAGCGG + Intronic
1042366800 8:67946431-67946453 GAGCCTGTGTAGAGGAAAAGAGG - Intergenic
1042877682 8:73454919-73454941 GTGGCTGTGGAGAGGTCGAGTGG + Intronic
1044492253 8:92833479-92833501 GCTGCTGTGTAGAAACAGACTGG + Intergenic
1046790235 8:118313901-118313923 GTGTGTGTGTAGAGGGAGAGAGG + Intronic
1046804873 8:118469091-118469113 GCTGCTGTGTGGAGGAAGGGCGG - Intronic
1047914839 8:129571951-129571973 GAAGCTGTGAGGAGGCAGAGAGG - Intergenic
1048185202 8:132234196-132234218 GGGGCTGTGCAAAGGCAGAGGGG - Intronic
1048251701 8:132871486-132871508 GCTGGTGTGTGGACGCAGAGGGG + Exonic
1049399254 8:142417546-142417568 GCTCCTGTGAGGAGGCAGAGCGG - Intergenic
1049406980 8:142455961-142455983 GCGCCTGTGTAGTGCCAGGGAGG + Intronic
1049469612 8:142769489-142769511 GGGGCTGGGCAGAGGAAGAGGGG + Intronic
1049610501 8:143552867-143552889 GAAGCTGTGAAGAGGCAGGGTGG + Intergenic
1050405446 9:5304233-5304255 ACGGCTGAGTAGGGGCTGAGCGG + Intronic
1050408748 9:5339399-5339421 ACGGCTGAGTAGGGGCTGAGCGG + Intronic
1053575821 9:39357015-39357037 GCGGCTGGGCTGGGGCAGAGAGG + Intronic
1054097389 9:60915706-60915728 GCGGCTGGGCTGGGGCAGAGAGG + Intergenic
1054118795 9:61191336-61191358 GCGGCTGGGCTGGGGCAGAGAGG + Intronic
1054588960 9:66991226-66991248 GCGGCTGGGCTGGGGCAGAGAGG - Intergenic
1056939297 9:90941489-90941511 GCTGCTGTATGGAGCCAGAGAGG - Intergenic
1057629894 9:96711073-96711095 GCTGCAGTGTAGACGCACAGTGG - Intergenic
1059539025 9:115112462-115112484 GCTGCTGTGGAGAGACAGGGAGG - Intronic
1060004697 9:119989568-119989590 GCCCCTTTTTAGAGGCAGAGTGG - Intergenic
1060180727 9:121531847-121531869 CAGGCTGTGTGGAGGAAGAGTGG + Intergenic
1060917922 9:127402442-127402464 GCAGATGTGCAGAGGCAGCGAGG + Intronic
1061937229 9:133864545-133864567 GTGGCTGTGTGGAGGCTGACGGG - Intronic
1203364231 Un_KI270442v1:243382-243404 GGGGCTGGGTAGGGGCAGGGCGG + Intergenic
1186513028 X:10145102-10145124 GCAAATGTGTAGAGACAGAGAGG - Intergenic
1187391274 X:18887923-18887945 GAGGTTGGGGAGAGGCAGAGAGG + Intergenic
1189897234 X:45668251-45668273 GAGGCTGTGAAGAGGCATGGAGG - Intergenic
1190328109 X:49219048-49219070 GTAGCTGGGTAGAGGCAGAAGGG - Intronic
1190718590 X:53127565-53127587 GGGGCTGTGAAGAAGCAGTGAGG + Intergenic
1191123028 X:56925890-56925912 GCTGCTGTGCAGAGGCACAGGGG + Intergenic
1200098038 X:153673340-153673362 CCGGATGTGTGGAGGCAGAGAGG - Intronic
1200108336 X:153726347-153726369 GCGGCAGTGGAGAGGCAGGAAGG + Intronic