ID: 907336859

View in Genome Browser
Species Human (GRCh38)
Location 1:53705337-53705359
Sequence ATTTAGATGCAGAGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907336859_907336864 3 Left 907336859 1:53705337-53705359 CCTCCCTCACTCTGCATCTAAAT 0: 1
1: 0
2: 0
3: 18
4: 229
Right 907336864 1:53705363-53705385 AACCAGGCAGTAAATCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 186
907336859_907336868 29 Left 907336859 1:53705337-53705359 CCTCCCTCACTCTGCATCTAAAT 0: 1
1: 0
2: 0
3: 18
4: 229
Right 907336868 1:53705389-53705411 TGGCAAGTGCTGATCAATACAGG 0: 1
1: 0
2: 1
3: 6
4: 85
907336859_907336863 2 Left 907336859 1:53705337-53705359 CCTCCCTCACTCTGCATCTAAAT 0: 1
1: 0
2: 0
3: 18
4: 229
Right 907336863 1:53705362-53705384 AAACCAGGCAGTAAATCTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 186
907336859_907336866 9 Left 907336859 1:53705337-53705359 CCTCCCTCACTCTGCATCTAAAT 0: 1
1: 0
2: 0
3: 18
4: 229
Right 907336866 1:53705369-53705391 GCAGTAAATCTCCAGGGAAATGG 0: 1
1: 0
2: 2
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907336859 Original CRISPR ATTTAGATGCAGAGTGAGGG AGG (reversed) Intronic
900731279 1:4262481-4262503 ATATACAGACAGAGTGAGGGGGG + Intergenic
900837612 1:5017808-5017830 AGGTAGATGCAGAGTGAGTGAGG + Intergenic
901906759 1:12419127-12419149 ATATAGATCCAGGATGAGGGTGG - Intronic
902192762 1:14775055-14775077 TCTTAGGTGCAGAGTGTGGGTGG - Intronic
905491561 1:38348184-38348206 ATTTATATGCTGATTGAAGGTGG - Intergenic
905696136 1:39975064-39975086 ATTGAGATGGAGAGGGAGAGGGG + Intergenic
906536086 1:46551682-46551704 AATGAGAGGCAGGGTGAGGGGGG + Intergenic
907317540 1:53582028-53582050 ATTTGAATGCAGAGTTGGGGAGG + Intronic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
910449331 1:87330264-87330286 TTTTAAAAGGAGAGTGAGGGAGG - Intronic
910840184 1:91553932-91553954 ATTTACATGCAGAATGACTGTGG + Intergenic
911386276 1:97179187-97179209 ATTGAGATACAGAGTAAGGCTGG - Intronic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
913442409 1:118911907-118911929 ATTAAGAGGTAGAGTGAGAGTGG - Intronic
913556222 1:119969808-119969830 ATGAAGATGAAGAGTGTGGGGGG - Intronic
914957469 1:152176244-152176266 TTTTGGGTGAAGAGTGAGGGAGG + Intergenic
914978373 1:152388783-152388805 ATTTAGATGCTGTATGAGGCAGG + Intergenic
915542971 1:156580388-156580410 ACCTAGATGATGAGTGAGGGGGG + Intronic
917191862 1:172426517-172426539 AATGAGAGGCAGGGTGAGGGTGG - Intronic
919488097 1:198169478-198169500 ATTTAGTGGCAGAGTGAGTCAGG - Intronic
919766099 1:201128114-201128136 AGTTCGATGTGGAGTGAGGGTGG - Intergenic
920421770 1:205839489-205839511 AGTTAAATGCAGATTTAGGGTGG + Intronic
920761657 1:208788981-208789003 GTTTAGATGCAGATTTCGGGGGG + Intergenic
920868161 1:209770219-209770241 ATATTAAAGCAGAGTGAGGGCGG - Intronic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
923188592 1:231597855-231597877 ATTTATTTGGGGAGTGAGGGTGG + Intronic
923255392 1:232217514-232217536 AATTAGATGTGGATTGAGGGAGG - Intergenic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064938619 10:20708129-20708151 ATTTAGAAGCAGAGTCAGCTTGG - Intergenic
1066569941 10:36760472-36760494 AAATAGATGCAGGCTGAGGGAGG - Intergenic
1069596880 10:69677801-69677823 TTCTAGATGCTGAGTGGGGGAGG - Intergenic
1069751575 10:70748527-70748549 ATGTAGGGGCAGGGTGAGGGTGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1071536601 10:86438153-86438175 AATCACATGCAGAGTGAGTGTGG - Intronic
1071785215 10:88892084-88892106 TTTGAGATGCAGGGTGAGGGAGG + Intronic
1072677486 10:97479090-97479112 GTATAGAGGCAGAGGGAGGGAGG - Intronic
1074291695 10:112142510-112142532 ATTTGGATGGTGATTGAGGGAGG - Intergenic
1074435155 10:113427488-113427510 ATTTATAGGCAGAGAGAAGGAGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076547195 10:131253313-131253335 AGTGAGGGGCAGAGTGAGGGCGG - Intronic
1077756179 11:5030194-5030216 ACTTAAAGGTAGAGTGAGGGAGG - Intergenic
1078092162 11:8270671-8270693 ATATAAATGCAGAGATAGGGCGG - Intergenic
1078391196 11:10937014-10937036 ATTCTGATGCACAGTGAGGGTGG - Intergenic
1078443394 11:11385922-11385944 ATCTGGATGCAGACTGAGGTAGG + Intronic
1080685201 11:34509599-34509621 TTTTATATCCTGAGTGAGGGGGG + Intronic
1080727786 11:34915637-34915659 AACTACATGCAGCGTGAGGGTGG + Intronic
1081141972 11:39512669-39512691 ATTTAGAAGCAAAGTGTTGGAGG - Intergenic
1082612591 11:55319550-55319572 CTTTATATGTAGAGTGAGAGTGG + Intergenic
1082833617 11:57637564-57637586 ATTAAGATGCAGGGCGAGGCTGG - Intergenic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086989683 11:93289280-93289302 TTTTGGAGGCAGAGTGAAGGAGG - Intergenic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087161046 11:94948416-94948438 GTTTTGAAGCAGAGGGAGGGAGG - Intergenic
1087384479 11:97453152-97453174 ATTTGGATAAAGAATGAGGGAGG + Intergenic
1087765798 11:102151880-102151902 AATTATGTACAGAGTGAGGGAGG + Intronic
1088501167 11:110484599-110484621 ATTGAAATGCAGAGGGTGGGAGG - Intergenic
1088755777 11:112884005-112884027 ATTAACATAGAGAGTGAGGGGGG + Intergenic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1090792806 11:130106571-130106593 ATTTTGAGGCAGAGAGATGGTGG - Intronic
1093800123 12:23362833-23362855 ATTTAGATGGGGGGTGTGGGTGG + Intergenic
1094303155 12:28988862-28988884 ATTTTGTAGGAGAGTGAGGGAGG - Intergenic
1095583791 12:43829135-43829157 ATTTAGATACACAGTAATGGGGG - Intergenic
1095715486 12:45341755-45341777 GTGTAGAGGCAGAGTGAGTGGGG + Intronic
1096661315 12:53126184-53126206 AGTTGGAAGCAGAGTGAGAGAGG - Intergenic
1097362235 12:58670781-58670803 AGTTAGATGAAGAGAGTGGGTGG + Intronic
1098109085 12:67102644-67102666 AGAGAGATGCAGAGAGAGGGAGG - Intergenic
1099214847 12:79840959-79840981 ATTGAGATTCAAAGTCAGGGCGG - Intronic
1099335816 12:81355766-81355788 ATTTATATGAAGACTGAGAGAGG - Intronic
1099603096 12:84766478-84766500 ATTTATATGGAGAGTGCAGGTGG + Intergenic
1099855257 12:88156469-88156491 ATTTAAATGCAGAGGGATGGTGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1107410698 13:40155962-40155984 ATGAAGATAGAGAGTGAGGGAGG + Intergenic
1108246177 13:48516542-48516564 ATTTAGATGCAGAGATATGCAGG - Intronic
1108851750 13:54738537-54738559 ATTTTGATAGAGAGTGAAGGAGG + Intergenic
1112867928 13:103930116-103930138 ATTTAGAAGAGGAGTGAGGTGGG + Intergenic
1113037510 13:106067186-106067208 TTATTGATGCAGAGTGAGTGGGG + Intergenic
1113590319 13:111494347-111494369 ATTTAGATGCAGAAACAGGGAGG - Intergenic
1115091525 14:29582804-29582826 ATTTAGATCTAGAGTGAATGTGG + Intronic
1119438530 14:74612817-74612839 ATTGAGATCCAGAGCGAAGGCGG - Intergenic
1121981977 14:98462285-98462307 GTTTAAATGCATTGTGAGGGAGG - Intergenic
1122097568 14:99382741-99382763 AGCTAGATGCAGCGTGTGGGTGG + Intergenic
1122355156 14:101118492-101118514 ATTAAATTGCAGAGTGAAGGCGG - Intergenic
1122885517 14:104708724-104708746 ATTTAAGTGGTGAGTGAGGGAGG + Exonic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG + Intergenic
1125475591 15:40046205-40046227 ATTTTGATGGGGAGGGAGGGAGG - Intergenic
1126508089 15:49431446-49431468 ATTAAGATGGGGAGTGAGAGAGG + Intronic
1126554946 15:49976252-49976274 ATTTACATGGAGGGTGGGGGTGG - Intronic
1128353028 15:66904255-66904277 ATTAAGTGGCAAAGTGAGGGAGG - Intergenic
1130040708 15:80403953-80403975 ATTTAGATTCAGAGGGAAGCCGG - Intergenic
1130726660 15:86445987-86446009 CTTGAGATGGAGAGAGAGGGAGG + Intronic
1131762426 15:95638897-95638919 ATTTAGATGCTGGGTAAGGGGGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133121779 16:3612785-3612807 ATCTAGATGAAAAGTGAGAGCGG + Intronic
1133871398 16:9689989-9690011 AGTTAGAGGTAGAGAGAGGGTGG - Intergenic
1136146218 16:28317981-28318003 AGGTGGATGGAGAGTGAGGGTGG + Intronic
1136713435 16:32258581-32258603 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136754476 16:32670850-32670872 GATTAGACGAAGAGTGAGGGTGG + Intergenic
1136813637 16:33199515-33199537 GATTAGACGAAGAGTGAGGGTGG - Intronic
1136820113 16:33309595-33309617 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136826676 16:33366134-33366156 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1136831742 16:33464905-33464927 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1137065995 16:35843960-35843982 AGTTAGATACAGAGGGAGGGAGG + Intergenic
1140757158 16:78078052-78078074 CTATTGATGCACAGTGAGGGTGG + Intergenic
1140973681 16:80038665-80038687 ATTTGGAAGCAGGTTGAGGGAGG + Intergenic
1202992213 16_KI270728v1_random:22489-22511 GATTAGACGAAGAGTGAGGGTGG - Intergenic
1203056623 16_KI270728v1_random:931181-931203 GATTAGACGAAGAGTGAGGGTGG + Intergenic
1144488026 17:15683917-15683939 ATTTGGTTGCAAAGTGAGGCAGG - Intronic
1144779656 17:17801381-17801403 ACTAAGATGCAGAGAGAGTGAGG - Intronic
1148026265 17:44589787-44589809 ACTTAGAGGCAGGGAGAGGGAGG + Intergenic
1153369914 18:4303638-4303660 ATTGAGATGATGAGTTAGGGAGG - Intronic
1153715900 18:7847718-7847740 ATATAGATGCTGAGAGAGAGTGG - Intronic
1157269932 18:46265572-46265594 ATTAAGATGCAGAGGGGGAGGGG + Exonic
1158899955 18:61953388-61953410 ATTTCTAGGCAGAGTGAGAGAGG - Intergenic
1159018445 18:63122353-63122375 AGTTAGATTCAGACAGAGGGAGG + Intergenic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1159493457 18:69168420-69168442 ATTGAGATGCACAGTGAGCCAGG - Intergenic
1160346876 18:78139485-78139507 GTTTAGATGAAGAGCGTGGGCGG + Intergenic
1162091566 19:8283679-8283701 ATGTAGATGCAGACTGGGGGTGG - Intronic
1162093803 19:8298528-8298550 ATGTAGATGCAGACTGGGGGTGG - Intronic
1163885760 19:19963419-19963441 CTTTTGATGCAAGGTGAGGGTGG - Intergenic
1163949424 19:20570234-20570256 CTTTTGATGCAAGGTGAGGGAGG - Intronic
1167574562 19:50311961-50311983 ATTTTGGTGGGGAGTGAGGGTGG + Intronic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
929800267 2:45093781-45093803 ACTGGGATGCAAAGTGAGGGTGG + Intergenic
930758686 2:55006951-55006973 AGTCAAATGCAGAGTGAGGCAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
936661694 2:114550112-114550134 ATTTAAATGAAAAATGAGGGAGG - Intronic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937937759 2:127259687-127259709 ATTTAGATGCTGTGTGCTGGGGG - Intronic
938719786 2:134056341-134056363 ATTAAGATTCAGCGAGAGGGAGG - Intergenic
938727842 2:134122471-134122493 ATTTAAAAGCAGGGTGATGGAGG - Intronic
939529104 2:143335393-143335415 TTTTAGATGCTGAGTCAGAGCGG + Intronic
939933782 2:148263349-148263371 ATTGGGAGGCAGAGAGAGGGAGG + Intronic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
942202711 2:173587979-173588001 AAATAGAAGCAGAGTGAGAGAGG + Intergenic
942262925 2:174188628-174188650 ATTTAAATTCAGAGTCAGGAAGG + Intronic
943299369 2:186178675-186178697 ATATAGTTGCAGATTGAGGGTGG - Intergenic
946465490 2:219908434-219908456 ATTTAGATTCACAGAGAGGGAGG + Intergenic
946671016 2:222104545-222104567 ATTTCCATGCAGATTTAGGGTGG - Intergenic
948044989 2:234936616-234936638 ATTTCAATGCAGAGCGAGGGCGG + Intergenic
1168881290 20:1208372-1208394 ATGTAGAGGCAGAGTGGAGGGGG + Intergenic
1169453024 20:5728452-5728474 GTTCAGGTGCAGAGTGAGAGAGG + Intergenic
1169586284 20:7089774-7089796 ATTAAAATGTAGAGAGAGGGAGG + Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1174713235 20:52728975-52728997 ATTTATATGGAGGGTGAGGTGGG - Intergenic
1175451171 20:59069915-59069937 ATTCAGCTGCAGTGTGAAGGAGG + Intergenic
1178090695 21:29160068-29160090 GCTCAGATGTAGAGTGAGGGGGG - Intronic
1178472131 21:32903311-32903333 AATTACATGCATAGTTAGGGAGG - Intergenic
1178660258 21:34501800-34501822 ATTCAGCTGCAGAGTGAATGGGG - Intergenic
1178866347 21:36330709-36330731 GTTAAGATGTAGAGTGGGGGAGG + Intronic
1179006312 21:37518480-37518502 TTTTAGATTCAGAGTTGGGGTGG + Intergenic
1179016432 21:37597730-37597752 CTTTATTTGCAGCGTGAGGGTGG - Intergenic
949739673 3:7216627-7216649 ATTTTTAGGGAGAGTGAGGGTGG - Intronic
949873442 3:8608353-8608375 ATTCAGAGGCAGACAGAGGGAGG - Intergenic
950694940 3:14691577-14691599 ATTTTGAGGCAGAGAGAGAGAGG + Intronic
950958644 3:17081261-17081283 AATCACATGCAGTGTGAGGGAGG - Intronic
951666449 3:25129828-25129850 CTTTTGGTGCAGAGTGATGGAGG + Intergenic
952198799 3:31103616-31103638 AATTAGATACAGAGTGACAGGGG - Intergenic
953596203 3:44317006-44317028 ATTTAGAAGAGGAGTGAGAGTGG - Intronic
953649921 3:44793055-44793077 ATTCAGATTCAGTGTGAGGTGGG - Intronic
959260376 3:104071837-104071859 TTTTAAATTCAGAGTAAGGGAGG + Intergenic
961004895 3:123398283-123398305 CTTTGGCTGCAGAGTGATGGAGG + Intronic
965827507 3:172745637-172745659 ATTTTCATGCAGACAGAGGGAGG + Intergenic
967155955 3:186692416-186692438 ATTCAGAGGCAGATTGAGGGAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
968791635 4:2668505-2668527 ATTAAGATGCATATTGTGGGCGG - Intronic
969387627 4:6865802-6865824 ATTCTGATGCAGAGTGGGGCTGG - Intronic
975690683 4:76959615-76959637 ATCTAGATCCAGAGTGAATGGGG + Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
980735470 4:136880840-136880862 TGTTAGAGGCAGAGTAAGGGAGG + Intergenic
980882588 4:138727941-138727963 ATTGAAATGCAGAGTCAGGTGGG - Intergenic
980935761 4:139224331-139224353 CTTTAGCTGCAGACTGAAGGCGG - Intergenic
981453239 4:144923490-144923512 CTTGAGATGCAGAGTTAGGGAGG - Intergenic
982849299 4:160292374-160292396 ATCTGAATGCAGAGAGAGGGAGG - Intergenic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
984182699 4:176504370-176504392 AATTAGATGGAGAGGGTGGGAGG - Intergenic
984709996 4:182876798-182876820 TTGTAGATTCAGAGTGAGGTGGG + Intergenic
986948553 5:13053328-13053350 ATTTTGTTCCAGAGGGAGGGGGG - Intergenic
987483060 5:18483883-18483905 TTTTAGATCCAAAGTGAGTGAGG - Intergenic
989014364 5:36912446-36912468 ATATAGATTCAGAGTAAGAGTGG + Intronic
992373132 5:76165883-76165905 ATTGAGATTGAGAGTGAGAGAGG + Intronic
996135046 5:119831419-119831441 ATTATGATGGAGAGTGAGGCTGG + Intergenic
997731963 5:136188072-136188094 ATTCAGATGAAGACTGAAGGAGG + Intronic
998523371 5:142820150-142820172 ATTTAGATGAGGAGTGCAGGTGG + Intronic
1000175822 5:158752598-158752620 ATTTCGTTACTGAGTGAGGGAGG + Intronic
1002679921 5:180953352-180953374 TTATAGATGCACATTGAGGGAGG + Intergenic
1002878883 6:1234806-1234828 ACCCAGATGGAGAGTGAGGGAGG + Intergenic
1005296091 6:24428755-24428777 GTTTAGATGCAAAGGGAGCGAGG + Exonic
1008139355 6:47814073-47814095 ATTGAGTTGCAGAGTGAAGCAGG + Intronic
1008737946 6:54569976-54569998 AAATAGATGCAGAATGAGTGAGG - Intergenic
1008788292 6:55197365-55197387 GTTTAGAGTCAGAGTCAGGGTGG - Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1010441233 6:75897000-75897022 ATCTTGATGCAGGGTCAGGGAGG + Intronic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012934996 6:105358476-105358498 ATCTAGATGTAGAGAGAGTGTGG + Intronic
1014231762 6:118911447-118911469 ACTAAGATGCAAAGTGAAGGTGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1017234614 6:152106087-152106109 ATTAAGATGCATACTGAGGCCGG - Intronic
1017755891 6:157528829-157528851 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755899 6:157528885-157528907 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755907 6:157528941-157528963 AATTAGATGAAGACTGGGGGTGG + Intronic
1017759961 6:157561033-157561055 ATTTAAATGCAGAGTGCAGAAGG + Intronic
1017905103 6:158752668-158752690 ATCTTGGTGCAGGGTGAGGGGGG + Intronic
1018377841 6:163230766-163230788 CTGTAGGTGCAGAGTTAGGGAGG + Intronic
1022516719 7:30979376-30979398 AGTCAGATGCAGAGACAGGGAGG - Exonic
1022639616 7:32169702-32169724 AGTTAGATGCATAGTCAGTGTGG - Intronic
1022911379 7:34902153-34902175 AGTTACAGGCAGAGTGGGGGTGG - Intergenic
1024504254 7:50148172-50148194 ATTTAGAAGCAGTGTGGGTGAGG + Intronic
1028789905 7:94842158-94842180 TTTTATATGCAGAGTGAGCTAGG + Intergenic
1029353700 7:100034094-100034116 TCTGTGATGCAGAGTGAGGGTGG - Exonic
1029473275 7:100767814-100767836 ATTCAGCTGCAGAGGCAGGGAGG - Exonic
1034888150 7:154814849-154814871 ATTTGGATGCAGAGACAGAGGGG - Intronic
1035640240 8:1179254-1179276 CCTTAGATGCAGAGTGGGGGTGG + Intergenic
1036037870 8:5040218-5040240 TTATGGATGCAGAGTGAGGTAGG + Intergenic
1039504561 8:38042608-38042630 ATTTGGATGCAGACAGAGGAAGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040576399 8:48655210-48655232 AATTAGTAGCAGAGTGAAGGAGG + Intergenic
1045030064 8:98126624-98126646 ATATAGATTCAGAGTCAGGAAGG + Intronic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1045750373 8:105476796-105476818 ATTTGGATGGAGAGTGGGGTGGG + Intronic
1049516151 8:143057957-143057979 AGAGAGATGCAGAGGGAGGGAGG - Intronic
1051061587 9:13051583-13051605 ATTTGGATGAAGAGGGAAGGAGG + Intergenic
1052449937 9:28616020-28616042 ATTGGGAGGCAGAGTGAGTGAGG + Intronic
1057142866 9:92738152-92738174 ATTGACAGGCACAGTGAGGGCGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1062252267 9:135604326-135604348 CTTAGGCTGCAGAGTGAGGGTGG - Intergenic
1062280662 9:135750317-135750339 ATTTGGAAGCAGGGTGGGGGTGG + Intronic
1185500907 X:596708-596730 ATTGAGATTGAGAGAGAGGGAGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190507420 X:51139806-51139828 ATTTAAATGAATAGTGAAGGAGG + Intergenic
1192106458 X:68321896-68321918 ATTTTGAGACAGAGTCAGGGTGG - Intronic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1196528419 X:116754432-116754454 AGTTAGCTGAAGAGTCAGGGAGG - Intergenic
1196604245 X:117637936-117637958 ATTTAGAGGCAGTATGATGGTGG - Intergenic
1197590310 X:128401677-128401699 ACTAAGATGCAGAGTGAATGTGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic