ID: 907337463

View in Genome Browser
Species Human (GRCh38)
Location 1:53709800-53709822
Sequence CTGCTCAGTGACTGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907337463 Original CRISPR CTGCTCAGTGACTGGGTGGG TGG Intronic
900598355 1:3492710-3492732 CTGCACTGTGACTGCGGGGGTGG - Exonic
900974204 1:6007185-6007207 CTGCCCAGTCACTGCATGGGGGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
903607400 1:24584954-24584976 GTGCCCAGTGAGTGGGTGGGCGG + Intronic
904285872 1:29452984-29453006 CTGCTAAGTGACTGGCTGCCTGG - Intergenic
905270258 1:36782990-36783012 AAGCTCAGTGTCTGGGTGTGAGG + Intergenic
905668309 1:39775518-39775540 CTGCCCACTGCCTGGATGGGAGG + Intronic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907551787 1:55310909-55310931 CTGCTGATTGACTGGATGTGGGG - Intergenic
909561586 1:77014462-77014484 CTGGGCAGGGCCTGGGTGGGGGG - Intronic
910171141 1:84378287-84378309 CAGTTCAGTGTCTGTGTGGGGGG - Intronic
912354096 1:109041534-109041556 CTGCTCAGTGCCAGGGCGAGGGG + Intronic
912498886 1:110108760-110108782 CTGGGCAGTGTCTGGCTGGGTGG + Intergenic
912935478 1:114000533-114000555 CTGCTCAGTGACAGGTGAGGAGG + Intergenic
913106623 1:115620289-115620311 CTGATCAGTGCGTGGGTGAGGGG + Intergenic
914048973 1:144115536-144115558 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
914130211 1:144849909-144849931 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
915911382 1:159917770-159917792 CTTCTCAGTCACTGAGAGGGTGG - Intergenic
915932318 1:160068342-160068364 CTGCTCAGGCTCTGAGTGGGGGG + Intronic
916739372 1:167635183-167635205 TGGCTCAGTGAGAGGGTGGGTGG - Intronic
916984624 1:170177459-170177481 TTGCTGAATGATTGGGTGGGAGG + Intergenic
917365854 1:174231648-174231670 CTGCTCAGCTTCTGGGAGGGAGG + Intronic
917832507 1:178908029-178908051 CTGCTCACTAACTGGGTGACAGG - Intronic
918770334 1:188549352-188549374 TTGCTGGGGGACTGGGTGGGGGG + Intergenic
919566913 1:199200327-199200349 ATGCTCACTACCTGGGTGGGGGG - Intergenic
919666216 1:200295276-200295298 ATGCTCACTGCCTGGGTGAGAGG + Intergenic
922212771 1:223498231-223498253 CTTATCAGTCAGTGGGTGGGAGG - Intergenic
922737336 1:227994512-227994534 ATGCTCAGGGCCTGGGTGGGAGG - Intergenic
922783715 1:228272849-228272871 CAGCTCAGGGACAGGGTGGAAGG - Intronic
923210450 1:231799572-231799594 CTGCTCAGTCGCTGCCTGGGAGG - Intronic
923337865 1:232985758-232985780 CTGCTGTGTGAATGGGTGGAGGG + Intronic
923367477 1:233277132-233277154 CAGCTGACTGCCTGGGTGGGAGG + Intronic
923877151 1:238061872-238061894 CTGCTCAGTGATTGGGAGGATGG - Intergenic
923986438 1:239387240-239387262 CTGCCCAGCGCCTGGGTGGCGGG - Intronic
1062814392 10:489000-489022 CTGTTCAGTTACTGGGGGGCGGG + Intronic
1064619042 10:17195500-17195522 ATGCTCAGTGCCTGGGTGGTGGG + Intronic
1066541399 10:36450505-36450527 CTGCTCTGAGACAGTGTGGGAGG + Intergenic
1068220376 10:54037398-54037420 CTGCTCACTGATTAGGAGGGTGG - Intronic
1070572661 10:77651702-77651724 CTTCTCAGTGAGTTGGTGTGAGG + Intergenic
1070728308 10:78807563-78807585 ATGCTCAGTGACTGTGGGGTGGG + Intergenic
1070741491 10:78906168-78906190 CTGCACAGTCACTGGGGAGGTGG + Intergenic
1071877114 10:89853597-89853619 CTGCTAAGTGAATGGCAGGGAGG + Intergenic
1072269080 10:93757740-93757762 CTTATTAGTGAGTGGGTGGGCGG - Intergenic
1072662284 10:97370402-97370424 CTGCTCATAGACTGGGTGGGGGG - Intronic
1072692679 10:97582303-97582325 GTGCTCAGCAGCTGGGTGGGAGG - Exonic
1073549014 10:104380226-104380248 CTGCTCAGTGATGTTGTGGGTGG + Intronic
1074192632 10:111150888-111150910 GTGCTCAGTCACTGGCTGGGTGG - Intergenic
1075191785 10:120315987-120316009 CTGTTGAGTGACTGGATGGAGGG + Intergenic
1075220248 10:120578358-120578380 CTGCCCAGTGACTGTGGGCGGGG + Intronic
1075844403 10:125533982-125534004 CTGGTGGGTGACTGGGTGTGGGG + Intergenic
1075873808 10:125790014-125790036 CTGCTCACTTGCTGGGAGGGAGG - Intronic
1076107494 10:127835010-127835032 GTGCTCTGTGGCTGGGTGGTGGG + Intergenic
1076244784 10:128938399-128938421 CTGCTCAGAGCCTGGGTTGCAGG - Intergenic
1076293046 10:129362225-129362247 CTGCTCAGTGCCTGTGTGTGGGG - Intergenic
1076821001 10:132939534-132939556 CTGCTCAATGCCCAGGTGGGAGG + Intronic
1076850284 10:133089036-133089058 GGGCTCAGTGCCGGGGTGGGAGG + Intronic
1077032548 11:476051-476073 CTGCTCAGGGCCTCTGTGGGTGG - Intronic
1077136428 11:1001702-1001724 CTCCTCAGTGTCTTGGTGGCAGG + Intronic
1077176356 11:1192930-1192952 CAGCTCAGTGACGGGCTCGGAGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078099050 11:8318833-8318855 CTGCTCAGAGAGTGGAAGGGAGG + Intergenic
1078367504 11:10718883-10718905 CTGCTCAGCTACGGGGTAGGAGG + Intergenic
1078902052 11:15650790-15650812 CTGCACAGTGCCTGGGAGCGGGG - Intergenic
1079093412 11:17495903-17495925 ATGGTCAGTGAGTGGGTGAGTGG + Intronic
1079110540 11:17602766-17602788 GGGCTCAGTGAAAGGGTGGGAGG - Intronic
1079211617 11:18465917-18465939 TTGCTCAGTACCTGGGTGGCAGG - Intronic
1081301587 11:41459027-41459049 CTGCTCAGAGACTGGGGGCTGGG - Intronic
1082869351 11:57929897-57929919 CTGCTCATTGATTGGATGTGTGG + Intergenic
1083616598 11:64029350-64029372 AGGCACAGTGACGGGGTGGGGGG + Intronic
1084713041 11:70856048-70856070 CAGGTGAGTGAATGGGTGGGTGG + Intronic
1085409107 11:76281167-76281189 CTGCTCACTGTCTGGGGTGGGGG + Intergenic
1085528592 11:77178356-77178378 CTGATGAGTGAATGGATGGGTGG - Intronic
1085533809 11:77206436-77206458 CTCCTCAGAGACAGGGAGGGAGG - Intronic
1088626386 11:111733315-111733337 CAGCACAGTGTCTGGGAGGGTGG + Intronic
1089361639 11:117892608-117892630 ATGCTCAGTACCTGGGTGGCGGG - Intergenic
1089697379 11:120224596-120224618 GTACTCAGTGACTGTGTGGTGGG + Intronic
1089858992 11:121572286-121572308 GAGCTCAGGGGCTGGGTGGGAGG - Intronic
1090359280 11:126161342-126161364 CTGCAGGGTGACTGGGTGTGGGG - Intergenic
1091280491 11:134379226-134379248 CTCCTGAGTGGGTGGGTGGGTGG - Intronic
1092281531 12:7101377-7101399 CTACTCAGGGACTGAGGGGGAGG - Intronic
1092507881 12:9123442-9123464 CTACTAAGTGACTGGGGTGGGGG + Intergenic
1093218153 12:16386910-16386932 CTGCTAAGTGACTGACAGGGTGG - Intronic
1093813236 12:23512362-23512384 GAGCTCAGTGACTGGGGGTGGGG + Intergenic
1094064814 12:26351132-26351154 CTGATGAGTGACTTGCTGGGAGG + Intronic
1094317441 12:29149248-29149270 CGGCTCGGAGACTGGGTGTGGGG - Exonic
1094628920 12:32153010-32153032 ATGCTCAGTGTCTGGGTGATGGG - Intronic
1095267928 12:40181527-40181549 CTGTTCAGTCAGTGGGTGTGTGG + Intergenic
1095298190 12:40551026-40551048 CTGCTCAGTACCTGGGTGACAGG - Intronic
1096542983 12:52318547-52318569 CAGCTCAGAGACAGGGAGGGAGG + Intronic
1096657152 12:53098756-53098778 AAGCTGAGTCACTGGGTGGGTGG + Intronic
1097234121 12:57528262-57528284 CAGCTCAGGGACTGGGGGGTCGG - Exonic
1099520210 12:83650697-83650719 CTGTTCAGGGACTTGTTGGGAGG + Intergenic
1099670149 12:85680989-85681011 TTGTTTAGTGACTGGGAGGGAGG - Intergenic
1099836640 12:87914868-87914890 ATGCTCAGTAACTGGGTGATGGG + Intergenic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1101048086 12:100831764-100831786 CAGCTAAGTGGCTGGGTGGCAGG - Intronic
1101967218 12:109290057-109290079 CTGCACAGTGGGTGGGTGGCAGG + Intronic
1102217155 12:111169622-111169644 CTCCTCAGTGGCAGGGTGGTTGG + Intronic
1102347181 12:112167746-112167768 CTGCGCAGTGGCTGGGGTGGCGG - Intronic
1102368147 12:112357405-112357427 CTGCCCAGCTACTGGGTGGGGGG + Intronic
1103782241 12:123406701-123406723 CTGCACAGGCCCTGGGTGGGGGG - Intronic
1104187430 12:126446141-126446163 CATCTCAGTGACTGGATGGAGGG + Intergenic
1104399087 12:128460836-128460858 CAGCTCAGCAGCTGGGTGGGGGG + Intronic
1104906153 12:132214544-132214566 CTCCTGAGTGGTTGGGTGGGAGG - Intronic
1104954444 12:132457520-132457542 CGGGTGAGTGGCTGGGTGGGCGG + Intergenic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105917506 13:24930405-24930427 ATGCTCAGTATCTGGGTGAGGGG - Intergenic
1106215427 13:27693617-27693639 ATGCTCAGTACCTGGGTGAGAGG - Intergenic
1108705943 13:52987155-52987177 CTGCTCAGTACCTGGGTGACAGG - Intergenic
1108942670 13:55977298-55977320 TTGCTCATTGAGTGGGAGGGAGG - Intergenic
1109442594 13:62394712-62394734 TTGCTCAGTGATCGGGAGGGAGG - Intergenic
1109915777 13:68983556-68983578 TTGTTCAGTGAGTGGGAGGGAGG + Intergenic
1111211611 13:85087048-85087070 ATGCTCAGTGCCTGGGTGACAGG + Intergenic
1113098177 13:106688510-106688532 TTGCTGATTGGCTGGGTGGGGGG + Intergenic
1113928651 13:113954724-113954746 TTGCTCAGTGGCTTGTTGGGTGG - Intergenic
1113947036 13:114050173-114050195 TTGCTCAGTGTCTGCCTGGGAGG - Intronic
1114266760 14:21076857-21076879 CTACCCAGTGACTGGGAGAGGGG - Exonic
1114684299 14:24513544-24513566 CTGCTCAGGGAATGGGTCAGTGG + Intergenic
1116828055 14:49691185-49691207 CAGCTTGGTCACTGGGTGGGAGG - Intergenic
1117345767 14:54830615-54830637 ATGCTCAGTGCCTGGGTGACAGG - Intergenic
1117818963 14:59628525-59628547 CTAATAAGTAACTGGGTGGGAGG - Intronic
1118830920 14:69431659-69431681 ATGCTCAGTGCCTGGGTGATGGG - Intronic
1119041234 14:71276564-71276586 CTCCTCAGTGACTGGTTGGTTGG - Intergenic
1120307040 14:82784154-82784176 CTGCTCAGTACCTGGGTGACAGG - Intergenic
1120552871 14:85892668-85892690 TTTCTCAGAGAATGGGTGGGTGG - Intergenic
1121569413 14:94936242-94936264 CTGATCGGTGGGTGGGTGGGTGG - Intergenic
1121946901 14:98131856-98131878 ATGCTCAGTGGCTGTGTGGCTGG + Intergenic
1122259574 14:100506007-100506029 ATGCTCAGTAACTGGGTGAAGGG - Intronic
1122834115 14:104422786-104422808 CGGCTCAGTGACTGTGATGGGGG + Intergenic
1123039875 14:105486138-105486160 CTGCTCAGTGACAGGAGAGGGGG + Intergenic
1123151086 14:106182414-106182436 CTGCTCACTGTCTCTGTGGGAGG - Intergenic
1123418909 15:20115110-20115132 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1123446958 15:20338401-20338423 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
1123482175 15:20642090-20642112 CTGCTCAATGTCTCTGTGGGAGG - Intergenic
1123528130 15:21121649-21121671 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1123635842 15:22358278-22358300 CTGCTCAATGTCTCTGTGGGAGG + Intergenic
1124364592 15:29062956-29062978 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364611 15:29063031-29063053 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364620 15:29063068-29063090 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364636 15:29063143-29063165 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364643 15:29063180-29063202 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364660 15:29063255-29063277 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364675 15:29063329-29063351 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364681 15:29063366-29063388 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364688 15:29063403-29063425 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364697 15:29063440-29063462 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364714 15:29063515-29063537 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364721 15:29063552-29063574 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364730 15:29063589-29063611 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124364737 15:29063626-29063648 CTGGTCAGTGTCTGTATGGGTGG + Intronic
1124656927 15:31516381-31516403 CTGCTCAGTGACCCAGGGGGTGG + Intronic
1125424461 15:39535208-39535230 TTGCTCAGAGACTGGGAAGGTGG - Intergenic
1125597836 15:40899032-40899054 CTGGTCAGTCACTGCCTGGGTGG + Intronic
1126204551 15:46030360-46030382 ATGCTCAGTACCTGGGTGGCAGG - Intergenic
1128582896 15:68821120-68821142 CTGCTCTGTGGCTGAGTGAGGGG + Intronic
1128738369 15:70066317-70066339 TTGCTCCTTCACTGGGTGGGTGG + Intronic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1130088068 15:80795273-80795295 CTGCTCTCTGTCTGGGTAGGTGG + Intronic
1130398765 15:83529703-83529725 CTGCTCAGTGGGTGGGGCGGGGG + Intronic
1131489255 15:92848446-92848468 CTGCCCAGGTACTGGGAGGGTGG + Intergenic
1132671906 16:1105557-1105579 CTGCTCTGGGACTGAGTGGCTGG - Intergenic
1135488122 16:22883886-22883908 CTCCTCTGTGGCTGGCTGGGTGG - Intronic
1135828707 16:25754364-25754386 TGGCTAAGTGAATGGGTGGGTGG - Intronic
1136643921 16:31592175-31592197 CTTCTCAGAGGCTGGGTGAGAGG - Intergenic
1138046078 16:53726800-53726822 CTGCACAGTGACTAAGTGGAGGG - Intronic
1141136991 16:81472918-81472940 CTGCCCAGTGAGTGTGTGAGGGG + Intronic
1142313850 16:89330645-89330667 CAGTACAGTGACTGGGGGGGGGG + Intronic
1142328861 16:89437479-89437501 CTGCTCAGTGAGAGAGTGGGAGG - Intronic
1203138215 16_KI270728v1_random:1743664-1743686 ATGCTCAGTGTCTGGGTGACGGG + Intergenic
1144444023 17:15309735-15309757 CCACTGAGAGACTGGGTGGGTGG - Intronic
1144573465 17:16415225-16415247 CTGCTGGGTGGATGGGTGGGTGG + Intergenic
1144773908 17:17774566-17774588 CTGGTCACTGCCCGGGTGGGCGG - Intronic
1145253169 17:21307515-21307537 CTGCTGTGTGCCTGGGTGGCTGG + Intronic
1145323402 17:21780403-21780425 CTGCTGTGTGCCTGGGTGGCCGG - Intergenic
1146974098 17:37096328-37096350 CAGCTCAGAGACTGGGTGCCTGG - Intronic
1147591819 17:41688880-41688902 CGGCTCAGTGACTGGGGCAGAGG - Exonic
1147790771 17:43013255-43013277 CTGCTCAGCCACTGGGTGGTGGG - Exonic
1148107159 17:45124821-45124843 CGGGCCAGTGACTGAGTGGGTGG + Intronic
1149431946 17:56601221-56601243 CTGGTCACTGACTGGGTGCGAGG + Intergenic
1150513576 17:65782865-65782887 ATGCTCAGTAACTGGGTGACAGG + Intronic
1151353763 17:73546486-73546508 CTGCCTAGTGACTGGGGGTGGGG - Intronic
1151726759 17:75889627-75889649 CTGCTTAGTGACAGGGTTGAGGG + Exonic
1151815501 17:76469582-76469604 CTGCTCCCTGCCTGGGTTGGTGG + Intronic
1152044553 17:77927477-77927499 CTGCTCAGGGGCTGGGAGGCAGG + Intergenic
1152270387 17:79321088-79321110 CAGCTCAGTGATTGGATTGGTGG + Intronic
1152312025 17:79557365-79557387 CTTCTCCATGGCTGGGTGGGTGG - Intergenic
1152635393 17:81428676-81428698 CTGCTCAGAGGGTGGGTGTGTGG + Intronic
1153360770 18:4194101-4194123 ATGCTCAGTACCTGGGTGAGAGG - Intronic
1155183311 18:23366853-23366875 CTTCTCAATGACTGGATGTGTGG - Intronic
1155230469 18:23769040-23769062 ATGCTCAGTACCTGGGTGGCAGG + Intronic
1155447804 18:25930124-25930146 CTTCTCAGTGAGAGGTTGGGTGG + Intergenic
1155676819 18:28440196-28440218 CTGCTCAGTCCTTGGGAGGGGGG + Intergenic
1155937667 18:31770986-31771008 CTGCTCAGTACCTGGGTGATGGG + Intergenic
1156447730 18:37249579-37249601 CTCCTCAGGGACTGAGTGTGAGG - Intronic
1156686292 18:39651016-39651038 CTACTCAATGACTGTGTGGCTGG - Intergenic
1157306615 18:46522026-46522048 CTGACCAGTTCCTGGGTGGGCGG - Intronic
1157551634 18:48585815-48585837 GTGCTCAGTGGCTGGGTCGACGG - Intronic
1157559357 18:48635823-48635845 ATGCTGGGTGACTGGCTGGGAGG - Intronic
1158340739 18:56463282-56463304 ATGCTCAGTACCTGGGTGGCAGG + Intergenic
1160675735 19:390355-390377 CTGCTCGAGGACTGAGTGGGAGG - Intergenic
1160732791 19:648889-648911 CTCCTCAGTGACGGGGACGGTGG + Exonic
1162218728 19:9158118-9158140 CTATTCAGTGACTGGGGTGGAGG + Intronic
1162347672 19:10129768-10129790 CTGCCCAGGGACTGGGAAGGGGG + Intergenic
1162495182 19:11019487-11019509 CTGCCCAGTGACACGGCGGGAGG - Intronic
1162729850 19:12711717-12711739 CTGCTCTGTGGCTGATTGGGGGG - Intronic
1162824064 19:13240639-13240661 CTGCGCAGTGACTGTGTGTGTGG + Intronic
1163444630 19:17339260-17339282 CTGCTCAGTGAGTAGGCGGCGGG + Exonic
1163811217 19:19432993-19433015 TTCCTGAGTGACTGGGTGGTGGG + Intronic
1164576325 19:29407374-29407396 CTGTAGAGTGAGTGGGTGGGTGG + Intergenic
1165663150 19:37600269-37600291 ATGCTCAGTACCTGGGTGGTGGG + Intronic
1165825356 19:38702661-38702683 CTGCTCAGTTTCTGGGTCTGGGG + Intronic
1165885835 19:39077521-39077543 CAGGTCACCGACTGGGTGGGGGG - Intergenic
1165981846 19:39730965-39730987 CTGATCCATGACAGGGTGGGTGG - Intergenic
1166344389 19:42156326-42156348 GTGCTCTGTCACTGGGTGGGTGG - Intronic
1167611703 19:50510972-50510994 TTGCTTAGTGACTGGGGAGGGGG - Intronic
1167752252 19:51388136-51388158 GAGGTCAGTGAGTGGGTGGGGGG - Intergenic
1202688424 1_KI270712v1_random:68430-68452 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
925954406 2:8948430-8948452 ATGCTCAGTACCTGGGTGAGGGG - Intronic
926837839 2:17044183-17044205 TTCCTCAGTGACTGGGCAGGAGG - Intergenic
927510749 2:23642535-23642557 CTGCTCAGTGGCTGAGAGGGCGG - Exonic
927519503 2:23690404-23690426 CTGCTGGGTGTGTGGGTGGGCGG - Intronic
927636486 2:24820620-24820642 CTGTTCAGGGCCAGGGTGGGAGG + Exonic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
928666927 2:33558823-33558845 CTGGTCAGAGGCTGGCTGGGGGG + Exonic
928755836 2:34524763-34524785 CTGCTCAATGGCTGGGAGGCCGG + Intergenic
929367792 2:41181857-41181879 ATGCTCAGTGCCTGGGTGATAGG - Intergenic
929816633 2:45237845-45237867 CAGCTCAAGGGCTGGGTGGGTGG - Intergenic
929945390 2:46367657-46367679 CTGCTCTGAGACTGGCTGGCTGG + Intronic
931226790 2:60338682-60338704 GTCTTCAGTGACAGGGTGGGAGG + Intergenic
932092613 2:68819539-68819561 TTGCTCAGTCACTGGGTGATTGG - Intronic
934066807 2:88348896-88348918 ATGCTCAGTACCTGGGTGGTGGG + Intergenic
934512380 2:94955779-94955801 CTGCTCACTGTCTCTGTGGGAGG - Intergenic
935611381 2:105029367-105029389 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
936383970 2:112012310-112012332 ATGCTCAATGACTGGGTGTGGGG - Intronic
936783757 2:116067600-116067622 CTGCTCAGTATCTGGGTGACAGG + Intergenic
937077115 2:119115027-119115049 GTGCTCACTGGGTGGGTGGGTGG - Intergenic
937979757 2:127608005-127608027 CTGCTGAGTGTCTGGGGGGCTGG + Intronic
938259372 2:129884323-129884345 CTCCTCAGGTACAGGGTGGGTGG + Intergenic
938312160 2:130300517-130300539 CTGCTCAGTGCCTGGCTTGGAGG - Intergenic
938409592 2:131052957-131052979 GGGCACAGTGACCGGGTGGGGGG + Exonic
938469032 2:131543194-131543216 CTGCTCAGTGACCGGCTTAGAGG - Intergenic
938810769 2:134850881-134850903 ATGCTCACTAACTGGGTGGCGGG - Intronic
939808545 2:146804773-146804795 CAACTCAGAGACGGGGTGGGAGG - Intergenic
940092019 2:149931320-149931342 ATGCTCAGTGCCTGGGTGACAGG + Intergenic
940693553 2:156950637-156950659 ATGGTCAGTGACTGGGTGATGGG - Intergenic
940765803 2:157788440-157788462 CTGCTCAGTGACTAGCAGGATGG - Intronic
941995625 2:171599590-171599612 CTGCTCAGTTATCGGCTGGGAGG - Intergenic
943514006 2:188862386-188862408 CTGCTGAGTTTCTGGGTGGGAGG + Intergenic
944607368 2:201363980-201364002 CTGCTCAGACACAGGGAGGGAGG - Intergenic
946456722 2:219832454-219832476 CTGCTCTGTGCCTGGGAGGTTGG + Intergenic
947362026 2:229355439-229355461 TTACTAAGTGACAGGGTGGGAGG + Intergenic
947812442 2:233012948-233012970 CTCCTCAGTGAATGGATGGGTGG + Exonic
948100154 2:235366727-235366749 CTGTTCAGTTTCTGGCTGGGTGG - Intergenic
948647718 2:239418333-239418355 CTGAGCAGTGACTGTGTGTGCGG + Intergenic
1169191918 20:3663279-3663301 CTCCTCAGTGACAAGGTGGGAGG - Intronic
1169481240 20:5983410-5983432 TTTCTCAGTGGCTGGGCGGGTGG + Intronic
1170534646 20:17327638-17327660 CTGCTCGGTGACTTCGTGGAGGG - Intronic
1171240754 20:23565496-23565518 CAGCTCAGGGCCTGGGAGGGAGG + Intronic
1172168151 20:32911500-32911522 CGGCACAGTGAGTGTGTGGGAGG + Intronic
1172507675 20:35475661-35475683 CTCCTCACTTGCTGGGTGGGCGG + Intronic
1172690541 20:36786477-36786499 CTGCTCTGTCACTCGCTGGGGGG + Exonic
1173847188 20:46195619-46195641 CTTCAAAGAGACTGGGTGGGGGG - Intronic
1173993375 20:47319853-47319875 CTGCTGAGGGGGTGGGTGGGTGG - Intronic
1174123195 20:48282942-48282964 CTGCTGGGGGACAGGGTGGGAGG - Intergenic
1174550418 20:51357855-51357877 GTGATGAGTGGCTGGGTGGGTGG + Intergenic
1174943524 20:54958620-54958642 CTGCTGACTGACTAGGTTGGTGG + Intergenic
1176200963 20:63860393-63860415 CTGCTCAGCGTCTGGGTTAGAGG - Intergenic
1177781488 21:25626744-25626766 CTTCTCAGAGACTGGGTCTGAGG + Intergenic
1179728957 21:43356639-43356661 GTGCCCAGAGACTGGGTTGGTGG - Intergenic
1180553064 22:16556589-16556611 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
1180647441 22:17351276-17351298 TTGCTCATTGCCTGGGTGAGTGG - Intergenic
1180793823 22:18592215-18592237 CTGCAGAGCCACTGGGTGGGGGG - Intergenic
1180941485 22:19662153-19662175 CTGCTCACGGACTGGGAGCGGGG + Intergenic
1181227917 22:21403105-21403127 CTGCAGAGCCACTGGGTGGGGGG + Intergenic
1181250736 22:21531734-21531756 CTGCAGAGCCACTGGGTGGGGGG - Intergenic
1181351024 22:22257839-22257861 ATGCTCAGTGCCTGGGTGACGGG - Intergenic
1181474052 22:23157870-23157892 GTGCTGAGTGCCTGGTTGGGGGG + Intronic
1182085811 22:27560424-27560446 CTGGGCAGTGAGTGAGTGGGCGG - Intergenic
1182410685 22:30182917-30182939 TGGCTGAGGGACTGGGTGGGAGG - Intergenic
1182447332 22:30397375-30397397 CTGCTCAGAGCTTGGGCGGGGGG - Intronic
1183494464 22:38134791-38134813 CTGCTCTCTGGCTGGGCGGGGGG - Intronic
1183617084 22:38952423-38952445 CTGCTCTGTGCCCGGGTGGGAGG + Intergenic
1184224629 22:43122221-43122243 CAGCTCAGTGAGATGGTGGGAGG + Intronic
1184493791 22:44825756-44825778 CTGCTCAGTGCCTGGTTGGGGGG + Intronic
1184493800 22:44825790-44825812 CTGCTCGGTGCCTGGTTGGGGGG + Intronic
1184493808 22:44825823-44825845 CTGCTCGGTGCCTGGTTGGGGGG + Intronic
1184493816 22:44825856-44825878 CTGCTCGGTGCCTGGTTGGGGGG + Intronic
1184493822 22:44825889-44825911 CTGCTCCGTGCCTCGTTGGGGGG + Intronic
1184493840 22:44825949-44825971 CTGCTCTGTGCCTGATTGGGGGG + Intronic
1184637780 22:45848879-45848901 CTGTTCAGGGACCAGGTGGGTGG + Intergenic
1184760716 22:46542538-46542560 CTGCTCAGGGACAGTGTGGTGGG - Intergenic
1184864833 22:47196298-47196320 CCTCTCAGTGTCTGGGTGGAAGG + Intergenic
1185137146 22:49079603-49079625 CAGCTCAGGGGCGGGGTGGGGGG - Intergenic
1185367897 22:50445376-50445398 GTCCTCAGTGGCTGAGTGGGAGG + Exonic
950066169 3:10113729-10113751 TGGCTCAGTGGCTGGGTGTGTGG - Intergenic
950120748 3:10481002-10481024 CTGCTCTGAGACTAGGTGGCAGG - Intronic
950278065 3:11680892-11680914 CTGTTGAGTGAATGGGAGGGTGG + Intronic
950453761 3:13080377-13080399 CTGCTCGTCGACTGGGTGGATGG + Intergenic
950544482 3:13630380-13630402 CTGCTCAGTGAGGGGGCGAGGGG + Intronic
950633980 3:14302407-14302429 CTGCACACTGACTGGGCAGGCGG - Intergenic
952026730 3:29091706-29091728 CTCCTCAGTAACTGTGTGTGTGG - Intergenic
954434902 3:50490786-50490808 CTGCTCAGGGACTATGTGGCTGG - Intronic
954881441 3:53838423-53838445 CTGCACTGTGCCTGGGTGAGTGG + Intronic
955782691 3:62502789-62502811 CTGGTCTGTGTTTGGGTGGGTGG + Intronic
956109470 3:65856092-65856114 CAACTGAGGGACTGGGTGGGAGG + Intronic
958465615 3:94453989-94454011 CAGTTCAGTGAGTGGGAGGGAGG - Intergenic
959259827 3:104062986-104063008 GTACCCAGTGACTGGATGGGAGG + Intergenic
961012522 3:123446113-123446135 GTGCTCTGTGACTGGGACGGAGG - Intronic
963103309 3:141625175-141625197 ATGCTCAGTGCCTCTGTGGGAGG + Intergenic
964343750 3:155735202-155735224 CTGCGATGTGACTGGGTGGCGGG + Intronic
964779222 3:160316664-160316686 CTTCTCAGTGACTGGCTAGATGG + Intronic
966288873 3:178331035-178331057 CTGCACATTGACTGGGGGGCGGG + Intergenic
967038124 3:185663340-185663362 CCTCTCAGTTAGTGGGTGGGAGG - Intronic
967740059 3:192995006-192995028 ATGCTCAGTATCTGGGTGGCAGG - Intergenic
967964016 3:194946298-194946320 CTGCTCAGGAAATGGGTGTGGGG + Intergenic
968045988 3:195624192-195624214 CTGCCCACCGACTGGTTGGGGGG - Intergenic
968308666 3:197665895-197665917 CTGCCCACCGACTGGTTGGGGGG + Intergenic
968516290 4:1016989-1017011 CTTCTCGGTAACCGGGTGGGGGG + Intronic
968698759 4:2044906-2044928 CTGCTCAGAGGCTGGGAGGCTGG + Intergenic
968962262 4:3751618-3751640 ATGCTCAGGGACTGTCTGGGGGG + Intergenic
970279420 4:14437645-14437667 CTTCTCAGTGACTGGGAGGGAGG - Intergenic
970579621 4:17463377-17463399 GTGCTCTGTGACTGTGTGTGTGG - Intronic
970771212 4:19614955-19614977 CTGCTTAGAGCGTGGGTGGGGGG - Intergenic
972484418 4:39527915-39527937 CTGCGCGGACACTGGGTGGGTGG + Intronic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
975459386 4:74632744-74632766 CCTCTCTGTGCCTGGGTGGGTGG + Intergenic
975791335 4:77955049-77955071 CTGCTCAGTGAATTGCTGTGAGG - Intergenic
976153624 4:82118710-82118732 ATGCTCAGTGCCTGGGTGACGGG + Intergenic
976340273 4:83939509-83939531 ATGCTCAGTACCTGGGTGGTGGG - Intergenic
976398371 4:84582288-84582310 CTGCTCAGAGACTAGCTGGAGGG + Intergenic
976686849 4:87823195-87823217 CTGCTCACCCACTGTGTGGGTGG + Intronic
977935589 4:102799820-102799842 GTACTCAGTGGCTGGGGGGGGGG + Intronic
978800624 4:112752289-112752311 CAGCCCAGCGACTGGGTGAGTGG - Intergenic
979468563 4:121070478-121070500 GCGCTCAGGGACCGGGTGGGAGG + Intronic
979476607 4:121165540-121165562 CAGCTCAGTGCCTGGGTGCGTGG - Intronic
980622270 4:135323122-135323144 ATGCTCAGTACCTGGGTGGTAGG + Intergenic
980680316 4:136151955-136151977 TTGCTCAGTGAGTGGGAGAGAGG - Intergenic
982982449 4:162156794-162156816 ATGCTCAGTACCTGGGTGGTGGG + Intronic
984128832 4:175847495-175847517 CTACTAAGTGACTGAGTGGTGGG - Intronic
985019853 4:185675905-185675927 CTGCTTTATGAGTGGGTGGGGGG + Intronic
985758041 5:1730806-1730828 TTGCTCAGTGACTGGCAGGATGG + Intergenic
987061971 5:14251626-14251648 CTCCTCACTGACTGGGTGCAGGG + Intronic
989041459 5:37233544-37233566 CTGCTCTGTGGCAGGGTGGTGGG - Intronic
990515561 5:56528086-56528108 TTTCTCAGGGACAGGGTGGGGGG - Intronic
993722191 5:91332595-91332617 GTGAGCAGTGACTGGGTTGGAGG - Intergenic
995525742 5:113049360-113049382 CTGCCAAGTGGGTGGGTGGGGGG + Intronic
996393564 5:122989507-122989529 ATGCTAAGGGACCGGGTGGGGGG + Intronic
997734014 5:136200303-136200325 CTGCCCAGTGACAGAGGGGGAGG - Intergenic
997904326 5:137800120-137800142 CTGCTGGGTCACTGGCTGGGGGG - Intergenic
999198828 5:149801792-149801814 TAACTCAGTGACTGGGTGTGAGG + Intronic
999270535 5:150294155-150294177 CTGCTGAGGGTCTGGGTGGAGGG + Intergenic
1001689928 5:173625453-173625475 CTGGATAGTGAGTGGGTGGGAGG - Intergenic
1001913651 5:175541605-175541627 ATGCTCAGTCACTGGCTGAGGGG - Intergenic
1001999872 5:176191633-176191655 CTGCTCAGTGTCAGGCTGGAAGG + Intergenic
1002187000 5:177459171-177459193 CTGCTCAGCGACAGGGGTGGAGG + Exonic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1002799413 6:507162-507184 CTGCTGTGTGTGTGGGTGGGGGG - Intronic
1003260388 6:4511124-4511146 CAACTCAGGGACTGTGTGGGAGG + Intergenic
1004137229 6:12979108-12979130 GTGCTCAGTGGCTGGGTTGGAGG - Intronic
1004834533 6:19516131-19516153 CTGCACAGAGCCGGGGTGGGGGG - Intergenic
1006338578 6:33433513-33433535 CTGGGGAGTGACTGGGTGAGGGG - Intronic
1007774697 6:44218564-44218586 TTGCTAAGAGACTGGGTGGGAGG + Intergenic
1011029863 6:82910128-82910150 CTACTCAGTGTCTGTGTGTGTGG - Intronic
1012546031 6:100420482-100420504 ATGGTCACTCACTGGGTGGGAGG + Intronic
1012931096 6:105317664-105317686 CTGCTCAGGGACTGTGAAGGAGG + Intronic
1013877098 6:114845410-114845432 ATGCTCAGTACCTGGGTGAGAGG + Intergenic
1017555119 6:155555810-155555832 CTGCAAGGTGTCTGGGTGGGAGG - Intergenic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1019073281 6:169367106-169367128 GTGCTCAGTGCCTGGGTGATGGG - Intergenic
1019579072 7:1751178-1751200 GTGCTGAGTGAATGCGTGGGTGG - Intergenic
1019776077 7:2912910-2912932 ATGATGGGTGACTGGGTGGGTGG - Intronic
1022231566 7:28418769-28418791 CTGCTCATTGATTAGATGGGTGG + Intronic
1022501997 7:30887601-30887623 CTGCTGAGTGCCTGGGAGGGCGG + Intronic
1024125571 7:46291168-46291190 CTCCTCTCTGGCTGGGTGGGTGG - Intergenic
1024242499 7:47446508-47446530 CTGGGCAGAGGCTGGGTGGGAGG - Intronic
1024561249 7:50647448-50647470 CTGCTCAGTGACTGACAGTGAGG - Intronic
1025766805 7:64463743-64463765 CTACTCAGGGCCTGAGTGGGTGG + Intergenic
1026103787 7:67404609-67404631 CTGGTGAGTGGGTGGGTGGGTGG + Intergenic
1026461625 7:70619889-70619911 CTGAACAGTGAATGGGTGTGGGG - Intronic
1026492435 7:70874338-70874360 CATCTCAGTTACTGGGTGGGGGG + Intergenic
1026627735 7:72011286-72011308 CTCCCCAGTGTCTGGCTGGGAGG + Intronic
1026669876 7:72380652-72380674 CTGCTCAGTGGGTTGGTGGATGG + Intronic
1027650382 7:80859791-80859813 CAGCTCAGTGGCTGGCTGGCTGG + Intronic
1028305072 7:89252921-89252943 ATGCTCAGTAACTGGGTGACGGG + Intronic
1029652950 7:101906280-101906302 CAGCTCAGTGAGTGGCTGCGTGG - Intronic
1032755926 7:134890854-134890876 CTGCTCAGTGATGGGCTGGATGG - Intronic
1032845623 7:135749207-135749229 CTGCCCAGGTTCTGGGTGGGTGG + Intergenic
1033341696 7:140497230-140497252 CTACTCAGTGTCTGCGTTGGGGG + Intergenic
1033413509 7:141142021-141142043 ATGCTCAGTAACTGGGTGACAGG - Intronic
1035603360 8:912455-912477 ATGCTGAGTGAGAGGGTGGGTGG + Intergenic
1035670750 8:1415404-1415426 GTGCTCAGTGTCTGGGTGATGGG - Intergenic
1036775329 8:11607953-11607975 ATGCTTAGTGTCTGGGTAGGAGG - Intergenic
1038374266 8:27022821-27022843 CTGCTCTGTGACTAGATGTGTGG + Intergenic
1040435010 8:47381635-47381657 CTGGTCAGTAATTGGGTGGGAGG + Intronic
1041476063 8:58267593-58267615 ATGCTCAGTGTCTGGGTGATGGG - Intergenic
1041709340 8:60878876-60878898 CTTCTGGGTGGCTGGGTGGGTGG - Intergenic
1041751195 8:61262742-61262764 GTGCACAGTGACAGGGTGGCAGG + Intronic
1043509844 8:80939230-80939252 CAGCTCAGTGGCTGGGGAGGTGG + Intergenic
1044952283 8:97446160-97446182 CTTCTCAGTGCCTGGCTGTGTGG - Intergenic
1045270344 8:100655982-100656004 CTCCTCAAAAACTGGGTGGGAGG + Intronic
1045362015 8:101441654-101441676 CTGCTTAGACACTGGGTTGGAGG - Intergenic
1045944187 8:107776778-107776800 ATGCTCACTAACTGGGTGAGGGG - Intergenic
1046019320 8:108645400-108645422 ATGCTCAGTGCCTGGGTGATGGG + Intronic
1046953088 8:120036462-120036484 CTGTGGAGTGACTGTGTGGGAGG - Intronic
1047751493 8:127884144-127884166 CTCCTGAGTGACTGACTGGGAGG - Intergenic
1049353447 8:142176382-142176404 CAGCTCAGGGGCAGGGTGGGGGG + Intergenic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049617395 8:143581624-143581646 AGGCTCAGAGGCTGGGTGGGAGG + Intronic
1050099325 9:2101301-2101323 GTGCTCAGTGACTGTGTGATGGG + Intronic
1051525009 9:18032874-18032896 GTGCTCAGTGACTCTGTGTGGGG + Intergenic
1051857166 9:21581706-21581728 CTGCTCAGTTACCTGGTGTGGGG + Intergenic
1052190465 9:25655619-25655641 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
1052636785 9:31116752-31116774 ATGCTCAGTACCTGGGTGGCGGG - Intergenic
1053145916 9:35711997-35712019 CTCCTGAGTGACTCGGTAGGAGG - Exonic
1053361274 9:37488344-37488366 CTGCTGATTGACTGAGTGGCTGG + Intronic
1054926959 9:70599224-70599246 CTGCTCAGAGAATGGGTTGAGGG - Intronic
1057224961 9:93288226-93288248 CTGGTCAGTGACCCTGTGGGAGG - Intronic
1057915257 9:99050502-99050524 CTGCTCAATGGCTGGGGGGCCGG - Intronic
1058800555 9:108541008-108541030 CTGCCCTGTGATGGGGTGGGTGG + Intergenic
1061329626 9:129884508-129884530 GTGCTCGGTGACTGGGGAGGCGG + Intergenic
1061861051 9:133469023-133469045 CTGCTCAGTGCCCAGGTGGCAGG - Exonic
1062052010 9:134452246-134452268 CAGATGGGTGACTGGGTGGGTGG - Intergenic
1062476119 9:136728311-136728333 CTGCTCAGTGGCTGGCGGGCGGG + Intergenic
1062581713 9:137231831-137231853 CTGCCCAGTGCCTGGGGGGTGGG - Intronic
1203578284 Un_KI270745v1:23604-23626 CTGTTCAGTGACTGGGAGAAGGG + Intergenic
1185479735 X:437478-437500 CGGCTCTGGGAGTGGGTGGGGGG - Intergenic
1185504139 X:619494-619516 ATGCTCAGGGCCTCGGTGGGTGG - Intergenic
1185533181 X:838359-838381 ATGCTCAGTGCCTGGGTGATGGG + Intergenic
1185625419 X:1478001-1478023 CTCCTCTGTGATGGGGTGGGAGG - Intronic
1186386217 X:9112812-9112834 ATGCTCAGTGTCTGGGTGATGGG - Intronic
1186407103 X:9313732-9313754 CTGCTCAGAGAGGTGGTGGGTGG + Intergenic
1188326933 X:28816336-28816358 ATGCTCAGTAACTGGGTGATGGG - Intronic
1188343892 X:29040265-29040287 CGGCTCAGTGAATGGGTGACAGG + Intronic
1189268917 X:39736682-39736704 AGGCTCAGAGAGTGGGTGGGGGG - Intergenic
1189865335 X:45321691-45321713 CTGCTGAGTGGCTGGGTGGGTGG + Intergenic
1194966122 X:100290626-100290648 CTGCTCTGTCACTGGCTTGGAGG - Intergenic
1195570375 X:106393333-106393355 CTGCACTCTGAATGGGTGGGTGG - Intergenic
1195979403 X:110561441-110561463 CTGCTGAGTTCCTTGGTGGGGGG - Intergenic
1198968033 X:142248909-142248931 CTACTCAGTAACTGGGTGATAGG - Intergenic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1200152594 X:153958590-153958612 CTTCACAGTGGCTGGGAGGGTGG + Exonic
1200718801 Y:6580682-6580704 CTTCTCAGTGCCTGGGTGATAGG - Intergenic