ID: 907337865

View in Genome Browser
Species Human (GRCh38)
Location 1:53712175-53712197
Sequence CTGTGCAAAGGCCTGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907337865_907337870 24 Left 907337865 1:53712175-53712197 CCTTCTACCAGGCCTTTGCACAG No data
Right 907337870 1:53712222-53712244 TCTCAGGCTTCGACATGCACAGG 0: 1
1: 0
2: 1
3: 6
4: 84
907337865_907337868 8 Left 907337865 1:53712175-53712197 CCTTCTACCAGGCCTTTGCACAG No data
Right 907337868 1:53712206-53712228 TGCCTAAAGCAGTGCTTCTCAGG 0: 1
1: 0
2: 4
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907337865 Original CRISPR CTGTGCAAAGGCCTGGTAGA AGG (reversed) Intronic
No off target data available for this crispr