ID: 907345368

View in Genome Browser
Species Human (GRCh38)
Location 1:53773810-53773832
Sequence CACCCACAACTCCCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907345362_907345368 25 Left 907345362 1:53773762-53773784 CCAGGTGGACACCAGGGCTTTGG 0: 1
1: 0
2: 3
3: 56
4: 346
Right 907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG 0: 1
1: 1
2: 1
3: 26
4: 206
907345366_907345368 -6 Left 907345366 1:53773793-53773815 CCTCTCCTTTAGTGCAGCACCCA 0: 1
1: 0
2: 1
3: 11
4: 135
Right 907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG 0: 1
1: 1
2: 1
3: 26
4: 206
907345364_907345368 14 Left 907345364 1:53773773-53773795 CCAGGGCTTTGGAACTCATCCCT No data
Right 907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG 0: 1
1: 1
2: 1
3: 26
4: 206
907345365_907345368 -5 Left 907345365 1:53773792-53773814 CCCTCTCCTTTAGTGCAGCACCC 0: 1
1: 0
2: 3
3: 70
4: 307
Right 907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG 0: 1
1: 1
2: 1
3: 26
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907345368 Original CRISPR CACCCACAACTCCCCCAGAC TGG Intronic
900099332 1:954481-954503 CACCACCAACTGCCGCAGACTGG + Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
902819040 1:18932431-18932453 CACCCCTGACCCCCCCAGACTGG + Intronic
904547435 1:31286696-31286718 CACCCTCAAATTCCCCACACTGG + Intronic
904682662 1:32240206-32240228 TGGCCACAACACCCCCAGACTGG - Intergenic
905347197 1:37319198-37319220 CACGCACACCTCCAACAGACAGG - Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908090180 1:60677623-60677645 GACCCAAAACTACCCCATACTGG + Intergenic
908435239 1:64099182-64099204 CACAAACAACTCCCCGAGGCAGG + Intronic
912778511 1:112522670-112522692 CACCCTAAACTCTCCCACACAGG - Intronic
916086425 1:161273333-161273355 CACCCACACCCTCCCCAGCCAGG - Intronic
920020407 1:202951452-202951474 CACCCTCAACTCCCTCCCACAGG + Intronic
922801393 1:228366279-228366301 CCCCCACATCCCCCCTAGACTGG + Intronic
923121710 1:230998268-230998290 CAGCCTCAACTCTCCCTGACGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924124490 1:240836130-240836152 CACCCCCAACCCCACCAGAGCGG - Intronic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1068286402 10:54942275-54942297 AACCCACATCTCCCTCAGAATGG - Intronic
1071932979 10:90495180-90495202 CACCTACATCTCTCCAAGACTGG + Intergenic
1073693222 10:105834858-105834880 ACCCCACAACTCCCACAGATGGG - Intergenic
1074559891 10:114526221-114526243 CACCACCAAATCCCCCAAACAGG + Intronic
1075091925 10:119448581-119448603 CACCCTCAAATCTCCCAGGCAGG - Intronic
1077199489 11:1298377-1298399 CACCCACACCCTCCCCCGACTGG - Intronic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084179299 11:67438566-67438588 AACCCACCACTACCCCAGAGAGG + Intronic
1090385634 11:126356186-126356208 CTCCCACAACTACCCCGGTCAGG + Intronic
1090741800 11:129668916-129668938 CACCCCCAACACCGCCACACTGG - Intergenic
1093796158 12:23314759-23314781 CACCCTCCACTCCCACAGTCTGG - Intergenic
1094115515 12:26907959-26907981 CACCCAGAACTCTCACATACTGG + Intronic
1095431184 12:42136801-42136823 CACACACAAGTCGCCCAGGCTGG + Intronic
1096077406 12:48814288-48814310 CACCCCCAACGACCCCAGGCTGG - Intronic
1096700526 12:53380238-53380260 CCCCCCCAACCCCCCCGGACAGG + Exonic
1097008046 12:55932734-55932756 CACACACAACCCCCTCAGCCAGG + Intronic
1097971759 12:65640497-65640519 CACCATCACCACCCCCAGACAGG + Intergenic
1100329797 12:93572087-93572109 CACCCCCAACCCCGCCAGAGCGG + Exonic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1105782538 13:23716788-23716810 CACACACAACACTTCCAGACAGG - Intergenic
1105928168 13:25026896-25026918 CACCCAGAACTCACCTAGACTGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108004838 13:45935843-45935865 AACCCACAACTGCCACAGTCAGG + Intergenic
1113235726 13:108270476-108270498 CACCTCCAGCTCCCCCAGACTGG - Intronic
1119195096 14:72711913-72711935 CACCCCCACCACCCCCAAACTGG - Intronic
1119845443 14:77826166-77826188 CAGGCACAACTCCCAGAGACGGG - Intronic
1120619897 14:86750709-86750731 CACCCACCCCTTCCCCAGCCAGG + Intergenic
1120826581 14:88961659-88961681 TACCCCCAACTGCCCCAGCCTGG - Intergenic
1121517624 14:94563344-94563366 CACCCTCAACTCCTGCAGATGGG - Intronic
1121974501 14:98390369-98390391 GACTCACAACTCCACAAGACTGG - Intergenic
1122209563 14:100165972-100165994 CTCCCCCTACTCCCCCAGACAGG - Intergenic
1122209583 14:100166018-100166040 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209602 14:100166064-100166086 CTCCCCCAACTCCCCCAGACAGG - Intergenic
1122209631 14:100166133-100166155 CTCCCCCCACTCCCCGAGACAGG - Intergenic
1122209641 14:100166156-100166178 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209676 14:100166248-100166270 CTCCCCCCACTCCCCCGGACAGG - Intergenic
1122209687 14:100166271-100166293 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1202939743 14_KI270725v1_random:136104-136126 AACCCACCACCCCCCCCGACAGG + Intergenic
1125769604 15:42156388-42156410 CTCCCAGGACTCCCCCAGTCCGG + Intronic
1126845953 15:52760828-52760850 CCTCCACAACTCCACCAGAGGGG - Intronic
1128838597 15:70831477-70831499 CACCCACAGCTCTGTCAGACAGG + Exonic
1131075078 15:89490346-89490368 GACCCACAGCTCTCCCACACTGG - Intronic
1131096191 15:89655509-89655531 CACCCGCAACTCCGCCCGCCGGG + Intergenic
1131259458 15:90881032-90881054 CACCCACTACTGACCCACACAGG - Exonic
1132902781 16:2267656-2267678 CACTCACAACTCCCCCGTCCAGG + Intronic
1133231892 16:4370863-4370885 CACCCACACCCCCTCCAGCCCGG - Intronic
1137247524 16:46717755-46717777 CACTCCCCACTCCCCCAGGCTGG + Intronic
1140290035 16:73644763-73644785 CACCCTCAACTCCTCCAAATAGG + Intergenic
1141089934 16:81123317-81123339 CACCCCCAACCCCAGCAGACAGG + Intergenic
1141165926 16:81661115-81661137 CACCCACGTCTCTGCCAGACAGG + Intronic
1141516370 16:84547956-84547978 CCCCTCCAACTCCCCCAGCCCGG + Intronic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1143102549 17:4512406-4512428 CACCCACAGCCCCAGCAGACTGG - Intronic
1143473689 17:7191532-7191554 CACCCGCAACCGCCCCAGCCAGG + Intronic
1145019079 17:19415959-19415981 CACCCACCACGCCCCCTGCCAGG - Exonic
1146256233 17:31392615-31392637 CAGCCACCACTCCCCGAGCCTGG - Intronic
1148438800 17:47701223-47701245 CACCCACCAGTCCCACAAACTGG - Intronic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1152638970 17:81441880-81441902 CAACCACAACTTCCCCAGCGTGG + Exonic
1152905460 17:82968234-82968256 CACGCACAGCAGCCCCAGACTGG + Intronic
1155168577 18:23250311-23250333 CACCCTGAACTCCCAGAGACAGG - Intronic
1157267426 18:46239219-46239241 CACCCTCAAATCCCCCTAACTGG - Intronic
1157414166 18:47488483-47488505 CACCCACAACTCCAAGAGAGAGG + Intergenic
1157687048 18:49650992-49651014 CGCCCACTACTGCCCCAGCCGGG - Intergenic
1158231226 18:55257592-55257614 GACTCACAATTCCCCCAGGCTGG + Intronic
1159782393 18:72675292-72675314 CACCCTCAACACCTCCAGAAAGG - Intergenic
1161312907 19:3604590-3604612 CCACCCCACCTCCCCCAGACAGG + Intronic
1161330333 19:3683873-3683895 GTCCCACACCTCCCCCACACTGG + Intronic
1161371549 19:3914868-3914890 CACCCCCAACACCCCCCCACCGG + Intronic
1161779609 19:6282739-6282761 CCCCCACCACACCCCCTGACAGG - Intergenic
1161983428 19:7642105-7642127 CCCCCTCACCTCGCCCAGACTGG - Exonic
1162039581 19:7962021-7962043 CACCCAAAACTCCTCAGGACTGG - Exonic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1162381735 19:10335407-10335429 CACCCTCATCCCCCCCAGTCAGG + Intronic
1163153411 19:15427844-15427866 CACCCACATCTGCCCCTGTCTGG - Intronic
1163636450 19:18439050-18439072 CACTTCCAACTCCCTCAGACTGG - Intergenic
1163975943 19:20852462-20852484 CAGACACTACTCCCCCAGCCAGG - Intronic
1165797768 19:38528707-38528729 CGCCCCCCACTCCCCCAGGCGGG - Intronic
1167293276 19:48635880-48635902 CGCCCACCACTGCCCCAGCCGGG + Exonic
1167456576 19:49599476-49599498 CACCCACCACTCTACCAGGCGGG + Exonic
1167563347 19:50239927-50239949 CTCCCAAAACTCCCCCAGGCTGG - Intronic
1167631367 19:50628168-50628190 CACACACAGCTACCCCAGATTGG + Intronic
925207403 2:2018750-2018772 GATCAACAACTCCCCCAGAAAGG + Intronic
929739902 2:44589116-44589138 CCCCCACCACCCTCCCAGACGGG - Intronic
931817304 2:65917294-65917316 CACCCACAAGCCCTCCAGACAGG - Intergenic
932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG + Intronic
933713586 2:85344732-85344754 CACCAACCACTCCCCCTGGCAGG - Exonic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
935707691 2:105870797-105870819 CACCCTGAATTTCCCCAGACTGG - Intronic
936030701 2:109068093-109068115 CACCCACACCACCCCCTCACGGG + Intergenic
939216936 2:139250643-139250665 CCCCCACCACACCCCCTGACAGG - Intergenic
940894069 2:159063533-159063555 CATCCTCCCCTCCCCCAGACTGG - Intronic
941448514 2:165630555-165630577 CAGCAACAACTCCTCCAGCCTGG + Intronic
943350472 2:186791295-186791317 CCCCCACCCCTCCCCCTGACAGG - Intergenic
944532760 2:200683262-200683284 CCCCCACCACTCTCCCGGACGGG + Intergenic
947605771 2:231484142-231484164 CACCCACAGCGCCCCCACGCTGG - Intergenic
947732340 2:232438389-232438411 CCTCCACCCCTCCCCCAGACAGG + Intergenic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948825990 2:240573662-240573684 CACCCACACCTCACCCAGCCTGG - Intronic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1172672804 20:36645951-36645973 CACCCAGAACTCTCTCAGCCTGG + Exonic
1172918364 20:38461280-38461302 CCCCCACCTCTCTCCCAGACGGG + Intergenic
1177114945 21:17073926-17073948 CACTCACCACTCCCTCAGAGAGG - Intergenic
1178821483 21:35978955-35978977 CACCCACAACTGCCCCACATAGG + Intronic
1180064856 21:45407078-45407100 CACACACCCCTCCCCCAGCCCGG + Intronic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1184307354 22:43614667-43614689 CACCAACCAATCCCACAGACTGG - Intronic
1185411500 22:50685337-50685359 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411521 22:50685426-50685448 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411556 22:50685574-50685596 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411577 22:50685663-50685685 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411591 22:50685722-50685744 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411625 22:50685870-50685892 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411674 22:50686077-50686099 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411709 22:50686225-50686247 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411763 22:50686461-50686483 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411798 22:50686609-50686631 CAGCTACAACTCTCCCAGAGGGG - Intergenic
1185411826 22:50686727-50686749 CAGCTACAACTCTCCCAGAGGGG - Intergenic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
950473759 3:13203234-13203256 CACACACAACTCACCCACACAGG + Intergenic
951304942 3:21048030-21048052 CACCCTCAAATCCCCCATGCCGG - Intergenic
952074638 3:29681501-29681523 CCCACACAATCCCCCCAGACAGG + Intronic
952080952 3:29756730-29756752 TACCCACAACTCCCCAATTCAGG + Intronic
953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG + Intergenic
955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG + Intronic
960780333 3:121313096-121313118 CCCCCACCACCCTCCCAGACGGG + Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961077120 3:123992346-123992368 CACCCCCAACGCCCCCAGCCCGG - Intergenic
961307456 3:125968954-125968976 CACCCCCAACGCCCCCAGCCCGG + Intergenic
961962705 3:130868784-130868806 CCCCCACCACTCTCCCGGACGGG - Intronic
963296099 3:143548286-143548308 CACCCCCACCACCCCCAGACAGG - Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
966828834 3:183988533-183988555 CACCCTCATCTCCCCCATGCCGG - Intronic
967095835 3:186176538-186176560 CTCCCACACCTCCCCCATTCTGG - Intronic
968072093 3:195790541-195790563 CACCCTCAACACCCTCACACCGG - Exonic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968569124 4:1330081-1330103 AACCCACAAATGCCCCAGGCAGG - Intronic
969017684 4:4115442-4115464 CACCCAGAACTCCAGCAGGCAGG - Intergenic
969300772 4:6295674-6295696 CACCCACCACGCTCCCACACTGG - Intronic
969429408 4:7145397-7145419 CATCCACCACTCCCCCATGCTGG - Intergenic
975172455 4:71247773-71247795 CACCCAGAACCACCCCACACGGG - Intronic
977656996 4:99534134-99534156 CTCCCCCAACTCCCCCTGACAGG + Intronic
980990403 4:139734633-139734655 CACCCTTACCTCCCCCAAACAGG + Intronic
981410176 4:144420681-144420703 CACCCCCACCTTCCCCTGACAGG + Intergenic
981513700 4:145584820-145584842 CACCCACCACTGCCTGAGACAGG - Intergenic
986346150 5:6837206-6837228 CACCTCCATCTCCCCCAGATTGG + Intergenic
987994729 5:25262071-25262093 CCCCCCCAACACCCCCAGCCGGG - Intergenic
989379849 5:40800880-40800902 CCCCCACCACCCTCCCAGACGGG - Intergenic
989379949 5:40801134-40801156 CCCCCACCACCCTCCCAGACGGG - Intergenic
989387300 5:40866525-40866547 CACCCAGACCTCACCCAGACTGG - Intergenic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
997341169 5:133145686-133145708 CATCCACAACACTCCCAGAGAGG + Intergenic
998652848 5:144140876-144140898 CACGCACCACTGCCCCCGACAGG - Intergenic
998947772 5:147359679-147359701 CCCACACTACTCCCACAGACAGG - Intronic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1000159315 5:158582968-158582990 CCCCCACCACCCTCCCAGACGGG - Intergenic
1000774082 5:165395332-165395354 CTTCCTCAACTCCCCCCGACTGG - Intergenic
1004834924 6:19520098-19520120 CAACCACCACACCCCCAAACTGG + Intergenic
1006162955 6:32048598-32048620 CACCGCCAGCTCCCCCAGGCGGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006323266 6:33333584-33333606 CTTCCCCCACTCCCCCAGACAGG - Intergenic
1010017046 6:71116966-71116988 CCCCCACACCTCCCCCACTCTGG - Intergenic
1010661212 6:78572617-78572639 CACCCCCACCCCCCACAGACAGG - Intergenic
1014085369 6:117336320-117336342 CCCCCACCCCTCCCCCTGACAGG + Intronic
1016217167 6:141618254-141618276 CACCCAGAACTCCCGCTGGCCGG - Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1020263186 7:6542962-6542984 CACCCACAAGTCCTCGAGAGAGG - Intronic
1023376128 7:39557385-39557407 CACTCCCTACTCCCCCATACGGG - Intergenic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1026856570 7:73758992-73759014 CACCCACAAAGCCCCCTGCCAGG - Intergenic
1028417647 7:90596590-90596612 CCCCGACAACTTCCCCAAACTGG - Intronic
1029346193 7:99980494-99980516 CACACACACCTCCCACACACTGG + Intergenic
1029558984 7:101290021-101290043 CACACACACCTCCCACACACTGG - Intergenic
1034267735 7:149789390-149789412 CAGGGACAACTCACCCAGACAGG - Intergenic
1036660482 8:10705186-10705208 CACCCACCACACCCCCAGCCAGG + Intronic
1039884973 8:41649541-41649563 CAGCAGCAACTCCCCGAGACAGG + Intronic
1045282076 8:100757949-100757971 TTCCCACCACTCCCCAAGACAGG - Intergenic
1045703715 8:104896484-104896506 CCCCCAAAACTCCCTGAGACTGG + Intronic
1048866055 8:138762603-138762625 CACACACAACAGCCCTAGACGGG + Intronic
1048969323 8:139635750-139635772 CACCCACAACCCCCCCACTCAGG + Intronic
1048973440 8:139657864-139657886 CACCCACATCACCCCCATCCAGG + Intronic
1049270319 8:141692226-141692248 CACCCCAAAATGCCCCAGACAGG + Intergenic
1049351250 8:142165994-142166016 CACACACAATTCCACCAGAATGG - Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1051565828 9:18496989-18497011 CACCCTCCACTCCCCAAAACAGG - Intronic
1052006436 9:23355299-23355321 TATCCACTACTCTCCCAGACTGG - Intergenic
1052636731 9:31116036-31116058 CTCCCCTAACTCCCCTAGACAGG - Intergenic
1057023449 9:91718554-91718576 CAGCTACAACTCCCCCAGGATGG - Intronic
1057037848 9:91824748-91824770 CACACACAGCTCTCCCAGGCGGG + Intronic
1057237176 9:93370991-93371013 CACCCACTACTTCCCAACACTGG + Intergenic
1059104007 9:111496044-111496066 TACTCTCAACTCCCCCTGACAGG - Intergenic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1060670895 9:125468312-125468334 CACCCTCAACTCACCCACCCAGG - Intronic
1061452390 9:130675349-130675371 CAGCCCCATCTCCCCCAGAAGGG - Intronic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1203562679 Un_KI270744v1:71706-71728 CCCCCACATCCCTCCCAGACGGG - Intergenic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1189210500 X:39278369-39278391 CCCCCACCTCTCTCCCAGACGGG - Intergenic
1190984661 X:55489728-55489750 CCCCCGCAACACCCCCAGCCCGG + Intergenic
1194316740 X:92385964-92385986 CACCCACTACTCCCTCTGAGAGG + Intronic
1198277069 X:135105012-135105034 CACAGACTACTCCCCCATACAGG - Intergenic
1199758728 X:150889188-150889210 CACCCACAGTGCCCCCACACGGG + Intronic
1199848925 X:151711484-151711506 CACCCACCACACTCCAAGACAGG + Intergenic
1200107155 X:153720930-153720952 CACTAACAACTCCACCAGCCGGG + Exonic
1200624914 Y:5499286-5499308 CACCCACTACTCCCTCTGAGAGG + Intronic