ID: 907346164

View in Genome Browser
Species Human (GRCh38)
Location 1:53782566-53782588
Sequence GAAACTGTACAGAAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907346163_907346164 -8 Left 907346163 1:53782551-53782573 CCTGGTAGGATCAAAGAAACTGT No data
Right 907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907346164 Original CRISPR GAAACTGTACAGAAGCAGCA AGG Intronic
No off target data available for this crispr