ID: 907346164 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:53782566-53782588 |
| Sequence | GAAACTGTACAGAAGCAGCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907346163_907346164 | -8 | Left | 907346163 | 1:53782551-53782573 | CCTGGTAGGATCAAAGAAACTGT | No data | ||
| Right | 907346164 | 1:53782566-53782588 | GAAACTGTACAGAAGCAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907346164 | Original CRISPR | GAAACTGTACAGAAGCAGCA AGG | Intronic | ||
| No off target data available for this crispr | |||||