ID: 907353758

View in Genome Browser
Species Human (GRCh38)
Location 1:53855187-53855209
Sequence AATGATGCAGAGAGGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907353758_907353763 21 Left 907353758 1:53855187-53855209 CCAGAAGCCCTCTCTGCATCATT No data
Right 907353763 1:53855231-53855253 GCGATATGATTATCTGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907353758 Original CRISPR AATGATGCAGAGAGGGCTTC TGG (reversed) Intronic
No off target data available for this crispr