ID: 907357703

View in Genome Browser
Species Human (GRCh38)
Location 1:53889873-53889895
Sequence CGCAGCACGCAGGTTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907357703_907357709 15 Left 907357703 1:53889873-53889895 CCCAGAGAAACCTGCGTGCTGCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 907357709 1:53889911-53889933 TCCCGCCCGCCCTTCTCCCGAGG 0: 1
1: 0
2: 3
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907357703 Original CRISPR CGCAGCACGCAGGTTTCTCT GGG (reversed) Intergenic
907337524 1:53710133-53710155 GGCAGCACCCTGGATTCTCTGGG - Intronic
907357703 1:53889873-53889895 CGCAGCACGCAGGTTTCTCTGGG - Intergenic
910004025 1:82373108-82373130 AGCAGCATGCTGTTTTCTCTGGG + Intergenic
913063729 1:115230929-115230951 CTCAGCATGCAGCTTGCTCTGGG - Intergenic
915353446 1:155240842-155240864 AGCTGCACCCAGGTTTCTGTGGG - Intronic
915490208 1:156246468-156246490 CGCAGCACACAGGGCGCTCTGGG + Intronic
1065367709 10:24952175-24952197 AGCAGCACGCGGGGGTCTCTGGG + Intronic
1066048946 10:31618124-31618146 GGCCCCACTCAGGTTTCTCTGGG + Intergenic
1074197599 10:111203089-111203111 CCCAGCAGGCAGGGTTGTCTAGG + Intergenic
1078470312 11:11581092-11581114 CTCAGCAAGCCGGCTTCTCTCGG - Intronic
1081207482 11:40292859-40292881 TGCAGGACGCAGCTTTCTCCTGG - Exonic
1081604318 11:44517908-44517930 TGCAGGAGGCAGGCTTCTCTGGG - Intergenic
1083988252 11:66230929-66230951 CACAGCACGCAGGTACTTCTGGG + Exonic
1086375056 11:86191578-86191600 AGCAGCAAGCAGGTTGCTCTGGG + Intergenic
1089185770 11:116613768-116613790 CGCAGCACGCCGGCCACTCTGGG + Intergenic
1093490282 12:19697560-19697582 GGCAGAACGTAGGTTACTCTTGG + Intronic
1101144870 12:101831112-101831134 CGCAGGGGGCAGTTTTCTCTTGG - Intergenic
1101916005 12:108896644-108896666 CTCAGCTCCAAGGTTTCTCTGGG + Intronic
1102933343 12:116878818-116878840 CGCAGCACGGAAGTAACTCTGGG + Intronic
1103183802 12:118938463-118938485 ATCAACAGGCAGGTTTCTCTGGG - Intergenic
1103928785 12:124438138-124438160 GGCAGCTCACAGGTCTCTCTGGG - Intronic
1114525732 14:23366019-23366041 GGCAGCTCCCAGGTGTCTCTGGG + Intergenic
1116186815 14:41608356-41608378 CGCTGCCCGCAGGTCGCTCTGGG - Exonic
1122374780 14:101250560-101250582 GGCAGCACGCAGGATTCCCAGGG + Intergenic
1124193214 15:27598232-27598254 AGCCAGACGCAGGTTTCTCTTGG + Intergenic
1125579831 15:40777166-40777188 GGTTGCAAGCAGGTTTCTCTTGG - Intronic
1128934317 15:71732377-71732399 CAGAGCAGGCAGCTTTCTCTCGG + Intronic
1129605789 15:77024389-77024411 CGCACCAGGCAGGCTTCTCAGGG - Intronic
1133849129 16:9485536-9485558 TGCAGCAAGGAGGTTACTCTTGG + Intergenic
1138615287 16:58160568-58160590 CGCGGCACCCAGCTCTCTCTGGG + Intronic
1141170544 16:81687946-81687968 CTCAGCACACAGGGTCCTCTGGG + Intronic
1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG + Intergenic
1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG + Intergenic
1155333036 18:24737320-24737342 TGCAGGACACAGATTTCTCTTGG + Intergenic
1155626691 18:27843217-27843239 CTCAGCACGCAAGCTACTCTGGG + Intergenic
1157283945 18:46364480-46364502 GGCATCACGAAGGGTTCTCTGGG - Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
926822729 2:16871074-16871096 TGCTCCACGCAGGTTTCTATAGG + Intergenic
935782653 2:106521636-106521658 AGCAGCACCCTGGTTTGTCTAGG + Intergenic
948281583 2:236751363-236751385 CTGAGCACCCAGGTTTCTCCTGG - Intergenic
1171567582 20:26208998-26209020 TGCCGCACGCAGGTTTTTCCTGG - Intergenic
1172765056 20:37346548-37346570 CCCAGCTCGCTGGCTTCTCTGGG - Intronic
1175203691 20:57294893-57294915 AGCAGCTGGCAGGTCTCTCTAGG - Intergenic
1179173238 21:38989343-38989365 CTCAGCTTTCAGGTTTCTCTGGG + Intergenic
1179495928 21:41771306-41771328 CCTTGCACGCAGCTTTCTCTTGG - Intergenic
1179621287 21:42617804-42617826 CGCAGCAAGCAGCTCCCTCTGGG - Intergenic
1180786272 22:18549452-18549474 TGCAGCACCCAGGTGTCTCCCGG - Intergenic
1181131554 22:20735179-20735201 TGCAGCACCCAGGTGTCTCCCGG - Intronic
1181243194 22:21489006-21489028 TGCAGCACCCAGGTGTCTCCCGG - Intergenic
1183102804 22:35594217-35594239 CGCAGCACTCAGGCTCCCCTAGG - Intergenic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
1184978750 22:48081366-48081388 CGCACCGTGCTGGTTTCTCTTGG - Intergenic
950756070 3:15173732-15173754 AGCAGGAAGCAGGTTTCTCCAGG - Intergenic
954012303 3:47652256-47652278 CACAGCACCCAGGCTTCTGTGGG + Intronic
958183721 3:90091643-90091665 CACAGCACCCAGCTTTCTGTGGG + Intergenic
961667683 3:128503927-128503949 CGCAGCACCCGGGTCCCTCTTGG + Intergenic
969189329 4:5504354-5504376 GGCAGGACTCAGATTTCTCTTGG - Intergenic
974980068 4:68944576-68944598 TGCAGCCTGCAGGTTTCTTTTGG - Intronic
978622076 4:110642426-110642448 CCCACAATGCAGGTTTCTCTGGG - Intergenic
998314773 5:141173127-141173149 GGCAGCACACAGGGCTCTCTGGG - Exonic
998333582 5:141351017-141351039 CGCAGCACGGAGGTTCCCCACGG - Exonic
1000071132 5:157742155-157742177 CACAGAAAGCACGTTTCTCTGGG - Intergenic
1021146673 7:17097772-17097794 TGCAGCAGGCAGGTTTCTTCGGG - Intergenic
1034535068 7:151721186-151721208 CCCAGCACTCAGGCTTTTCTGGG + Intronic
1040481725 8:47833048-47833070 AGCAGCAGGGAGCTTTCTCTGGG - Intronic
1041136100 8:54760990-54761012 CACAGCACACAGGCATCTCTGGG + Intergenic
1046570287 8:115955574-115955596 CGAAGCACGCTGGTTGCTTTTGG + Intergenic
1056420658 9:86423453-86423475 CTCAGCAAGCCGGTTACTCTGGG + Intergenic
1185765837 X:2725164-2725186 GGCAGCAGGCAGGTTGCTTTAGG + Intronic
1186821058 X:13288462-13288484 AGAAGCAGGAAGGTTTCTCTTGG - Intergenic
1197458919 X:126714277-126714299 TGCAGCATGCAGCTATCTCTAGG - Intergenic