ID: 907360710

View in Genome Browser
Species Human (GRCh38)
Location 1:53912236-53912258
Sequence CTACTATTATTTAGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907360710_907360713 21 Left 907360710 1:53912236-53912258 CCATTTTCACTAAATAATAGTAG 0: 1
1: 0
2: 2
3: 23
4: 296
Right 907360713 1:53912280-53912302 GAATGACAAAAATAGACCCCCGG 0: 1
1: 0
2: 0
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907360710 Original CRISPR CTACTATTATTTAGTGAAAA TGG (reversed) Intergenic
900812110 1:4813231-4813253 ATTCTTTTATTTTGTGAAAAAGG - Intergenic
902094277 1:13929844-13929866 CTACGAGGATTTAATGAAAATGG - Intergenic
902352412 1:15867069-15867091 CTACAATTAGATAGTGATAATGG - Intronic
904134152 1:28298140-28298162 CCAAGATTATTTGGTGAAAATGG + Intergenic
905949208 1:41933234-41933256 GTTCTATCATTTACTGAAAAAGG + Intronic
906594695 1:47064701-47064723 ATACTAATATTGAGTGTAAATGG + Intergenic
906895985 1:49772904-49772926 CCACTATTATTTTGTTAAATAGG + Intronic
907360710 1:53912236-53912258 CTACTATTATTTAGTGAAAATGG - Intergenic
910817673 1:91309922-91309944 CTACTATCATTTAAAAAAAAAGG + Intronic
911182059 1:94870015-94870037 CTACTAGGATTTAGTGAAGATGG - Intronic
911381340 1:97118965-97118987 ATAATAATATTTAGTGACAACGG + Intronic
912725066 1:112051756-112051778 CTATTATTATTTCTTTAAAATGG + Intergenic
912916897 1:113824528-113824550 CTAATAATACTTAGTAAAAATGG + Intronic
913688011 1:121252564-121252586 CTACTGGCATTTAGTGCAAAGGG - Intronic
914039868 1:144040204-144040226 CTACTGGCATTTAGTGCAAAGGG - Intergenic
914149591 1:145027716-145027738 CTACTGGCATTTAGTGCAAAGGG + Intronic
915054804 1:153117222-153117244 TTACTCTTATGTGGTGAAAATGG + Intergenic
916902601 1:169245707-169245729 CGTCTATTTTTTAGTTAAAATGG - Intronic
917181357 1:172301557-172301579 CTACTATTATTTTCTGAAGATGG - Intronic
918504663 1:185239037-185239059 CTACTATTTTTAAGATAAAAGGG - Intronic
919722514 1:200853982-200854004 CTATTATTATTTTTTGAAACGGG + Intronic
920401176 1:205677389-205677411 CTGCTGTTATTTGGTGACAATGG - Intronic
920475333 1:206271063-206271085 CTACTGGCATTTAGTGCAAAGGG - Intronic
923418217 1:233786238-233786260 CTTCTGTAGTTTAGTGAAAAAGG + Intergenic
924207515 1:241728401-241728423 ATATTATTATTTACAGAAAAGGG + Intronic
924484036 1:244462223-244462245 GTGCTATTTTTTAATGAAAAGGG - Intronic
924692511 1:246364844-246364866 CTACCATTCTTCAGTGAAACTGG + Intronic
1062991753 10:1825878-1825900 TTATTATTATCTATTGAAAAAGG - Intergenic
1063203769 10:3810926-3810948 TTAATATTAATTAGTGAAAACGG - Intergenic
1065678212 10:28201060-28201082 CAACTATTATTTAGAGCACAAGG + Intronic
1068154140 10:53174447-53174469 TAAATATGATTTAGTGAAAAAGG + Intergenic
1068365586 10:56045183-56045205 TTACTATTATTAAGTGGAAATGG - Intergenic
1068537877 10:58260465-58260487 ACACAATTATTTAGAGAAAAGGG + Intronic
1068774770 10:60857708-60857730 CTATTATTATTCAATGAGAAGGG + Intergenic
1068816249 10:61317660-61317682 CTATTTTTATTTATTGAAAATGG + Intergenic
1068895457 10:62194796-62194818 CTGCTACTATTTATTAAAAATGG - Exonic
1071723376 10:88169943-88169965 CTCCTATTATGTAAAGAAAAAGG - Intergenic
1071939403 10:90572377-90572399 CAACTATTATTTAATTAAATAGG + Intergenic
1072167795 10:92830633-92830655 CTACTGATATCTAGTGAGAATGG - Intergenic
1072530993 10:96319219-96319241 CTATTAATTTTTATTGAAAATGG + Intronic
1073113521 10:101077247-101077269 CTGGTATTTTTAAGTGAAAAAGG - Intergenic
1073549439 10:104384261-104384283 CTAATATTCTTTAGTGATATTGG - Intronic
1077962841 11:7093071-7093093 ATATTAATATTTGGTGAAAAAGG + Intergenic
1079189238 11:18264366-18264388 CTTCTATTTTTCAGTGAAATAGG - Intergenic
1079728733 11:23913253-23913275 CTACTCTTATTTTGTAAATAAGG - Intergenic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1081519195 11:43865033-43865055 GGAGTATTATTTAGTGATAAAGG - Intergenic
1082643471 11:55692482-55692504 CTTTTATTATTTACTGTAAATGG - Intergenic
1082734723 11:56843696-56843718 CTAATTTTATTTAATGAAAATGG + Intergenic
1085373674 11:76037775-76037797 AGACTGTTATTTAGTGTAAATGG + Intronic
1085954872 11:81379636-81379658 CTACTATTATTATTTGACAAAGG + Intergenic
1087202075 11:95355829-95355851 ATGCTATTATTAAGTGAAATAGG - Intergenic
1087351153 11:97034338-97034360 CTACGATTCTTTATTGAAAGAGG + Intergenic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088525413 11:110748054-110748076 CTATTATTATTTAGTTCTAATGG - Intergenic
1090595055 11:128311766-128311788 GTACTATCTTTTAATGAAAATGG - Intergenic
1092049820 12:5460409-5460431 CTACTATGATATTCTGAAAAAGG - Intronic
1092506062 12:9101437-9101459 CTTCTATTATCTGGTGAGAAGGG - Exonic
1092658124 12:10709322-10709344 CTAATATTCTGCAGTGAAAAAGG + Intronic
1092797880 12:12131427-12131449 CTAGAATTCTTTAGTGAAAGAGG - Intronic
1093091889 12:14931042-14931064 CCACTATAATATAGTAAAAAGGG + Intronic
1093478535 12:19581588-19581610 ATACTATTTTTAAATGAAAATGG + Intronic
1093653204 12:21667594-21667616 CTAATAGTATTTAATGAATAGGG + Intronic
1093903795 12:24665480-24665502 GTAGTAATATTTATTGAAAATGG - Intergenic
1095311398 12:40701839-40701861 CTGCCATTCTTTAATGAAAAAGG - Intronic
1097851240 12:64412368-64412390 CTGTTATTATTTAAAGAAAATGG + Intronic
1098833360 12:75390806-75390828 CTACATTAGTTTAGTGAAAAGGG + Intronic
1100094548 12:91016234-91016256 CTATAATTATTTTGAGAAAAAGG + Intergenic
1100318986 12:93472287-93472309 CTACTATTATTGAAAGTAAAGGG + Intronic
1100515700 12:95325559-95325581 CTATTATTATTTTGTGGAGACGG + Intergenic
1100668169 12:96778627-96778649 CTTCTCTGATTTACTGAAAATGG + Intronic
1105464733 13:20628058-20628080 GAAATATTATTAAGTGAAAAAGG + Intronic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105599853 13:21876922-21876944 CTACTATTATTTTTTGAGACAGG + Intergenic
1105654755 13:22424162-22424184 CTACTATTATTAAGTACATATGG - Intergenic
1106744477 13:32685298-32685320 GTGGTATTAATTAGTGAAAAGGG + Intronic
1107182597 13:37478861-37478883 CTACTATTCTATACTGAATAAGG + Intergenic
1107537302 13:41348337-41348359 CTTCTATTTTTTAGTAGAAACGG + Intronic
1107740194 13:43442252-43442274 CTAGTATTGTTTACTGAAAAAGG + Intronic
1111079663 13:83286531-83286553 CAAGTCTTATTGAGTGAAAATGG - Intergenic
1111455268 13:88474944-88474966 CTACATGTATTTTGTGAAAAGGG - Intergenic
1112718605 13:102215788-102215810 CTTTTATTTTTGAGTGAAAAAGG + Intronic
1112987005 13:105463205-105463227 CTATCATTATTTACAGAAAAAGG - Intergenic
1114461299 14:22887649-22887671 CAAAAATTATTTATTGAAAAGGG - Exonic
1114588996 14:23842216-23842238 CTACAATAATTTGGTTAAAAGGG + Intergenic
1115185238 14:30680554-30680576 CTACTAAAATTCAGTGAGAATGG + Intronic
1115384229 14:32777021-32777043 CTACTATGAGTGAGGGAAAAGGG - Intronic
1117382237 14:55176189-55176211 TTACAATTAATTAGTAAAAATGG - Intronic
1117933218 14:60869794-60869816 ACATTATTATTTAATGAAAATGG - Intronic
1117952966 14:61101005-61101027 CTCCCATTTTTCAGTGAAAAAGG + Intergenic
1118769193 14:68930265-68930287 CTAAAATTATTTACTGAATAAGG - Intronic
1120645871 14:87073174-87073196 CAACTTTTATTCAGTGAAACAGG + Intergenic
1121896826 14:97656611-97656633 CTTCTATTGTTTAGTGAACAGGG + Intergenic
1123492648 15:20794847-20794869 GTACCAATATGTAGTGAAAAAGG + Intergenic
1123549149 15:21363939-21363961 GTACCAATATGTAGTGAAAAAGG + Intergenic
1126259742 15:46674681-46674703 CTACTTTTATTCTGTTAAAATGG - Intergenic
1126437155 15:48647293-48647315 CTTCAACAATTTAGTGAAAAGGG + Intergenic
1129569946 15:76671167-76671189 CTGCTAATATTTTGTGAAGATGG - Intronic
1130663126 15:85846887-85846909 GTTCTATTAATTACTGAAAAAGG - Intergenic
1202957484 15_KI270727v1_random:91161-91183 GTACCAATATGTAGTGAAAAAGG + Intergenic
1138683864 16:58707431-58707453 CCACTATTCTTTGCTGAAAAGGG + Exonic
1138841937 16:60520643-60520665 CTAACATCATTTATTGAAAAGGG - Intergenic
1139091773 16:63657431-63657453 CTTTTATTATTTAGAGAAATCGG - Intergenic
1143315481 17:6028937-6028959 CTCCTAGAATTTAGTGGAAAAGG + Intronic
1144238006 17:13281298-13281320 CAACTATTATCATGTGAAAATGG + Intergenic
1145253543 17:21310307-21310329 CTATTATAATTTAGAGAAATTGG - Intronic
1146099923 17:29971316-29971338 CTACTATTATTTGCAGACAATGG - Intronic
1146741986 17:35294348-35294370 CCACCATCATTTATTGAAAAGGG - Intergenic
1147032726 17:37653409-37653431 GATATATTATTTAGTGAAAAAGG + Intergenic
1147747425 17:42703477-42703499 CTATTATTATTTTGTGAGATGGG + Intronic
1148084091 17:44983990-44984012 CCACTAGCAGTTAGTGAAAAAGG + Intergenic
1149180448 17:53930692-53930714 GTACTATTATATAATGACAAAGG - Intergenic
1149313056 17:55414637-55414659 TTATTGTCATTTAGTGAAAAGGG + Intronic
1150418176 17:65004682-65004704 TTACTATTATTTATTGAGATAGG - Intergenic
1150793506 17:68219535-68219557 TTACTATTATTTATTGAGATAGG + Intergenic
1150985039 17:70186238-70186260 CTAGTATCCTTTAGTGAAACAGG + Intergenic
1152971919 18:170128-170150 CTATTTTTATTTAGTGGAGATGG - Intronic
1154450192 18:14469385-14469407 ATACCAATATGTAGTGAAAAAGG + Intergenic
1154994250 18:21624838-21624860 CTACTACCATTTTATGAAAAGGG - Intronic
1155173048 18:23281184-23281206 CTACAATTAGATAGTGATAACGG + Intronic
1155866445 18:30971949-30971971 CAACTATTATTTCTTGTAAAAGG - Intergenic
1164111818 19:22170421-22170443 CCAGTATTATTTACTGAATAGGG + Intergenic
1164196349 19:22966568-22966590 CCAGTATTATTTACTGAATAGGG + Intergenic
1167450587 19:49566190-49566212 TTTGTATTTTTTAGTGAAAACGG + Intronic
925788779 2:7460285-7460307 CTACTATAATTAACTTAAAATGG - Intergenic
928455609 2:31418114-31418136 AAATTATTATATAGTGAAAAGGG - Intergenic
928790767 2:34949848-34949870 CCAGTATTATTTATTGAATAGGG - Intergenic
929975370 2:46628711-46628733 TTATTATTATTTAGAGAATATGG - Intergenic
930916779 2:56701094-56701116 CTACTTTAATTTAGAGTAAAGGG - Intergenic
932543321 2:72680195-72680217 CTGCTATTATTTCAAGAAAAGGG + Intronic
933434656 2:82232937-82232959 TTTCTATTATTTATTAAAAATGG - Intergenic
935406364 2:102714156-102714178 ATAATATTATTAAGTGGAAATGG - Intergenic
936852236 2:116914392-116914414 TTACAAATATTTAGTGAAAATGG - Intergenic
937387941 2:121454085-121454107 CTACTCATATTTAGTGCCAAAGG + Intronic
939065287 2:137476552-137476574 CCAGTAATATTTAATGAAAAGGG + Intronic
939292123 2:140209751-140209773 CTACTATTATTTACTTTACATGG + Intergenic
939317400 2:140568559-140568581 CAACTATTATTTAATTAAATAGG - Intronic
940609590 2:155972051-155972073 CTGACTTTATTTAGTGAAAAAGG - Intergenic
941308490 2:163899390-163899412 CAACTATTATTTTGTTAAATAGG - Intergenic
943678408 2:190741188-190741210 CTACTCTTAATTACTTAAAAGGG + Intergenic
944380361 2:199102248-199102270 CTACTATTATTTTACAAAAATGG + Intergenic
944582492 2:201144105-201144127 TTACTAATTATTAGTGAAAAAGG + Intronic
944763184 2:202838652-202838674 CAATTATTATATAATGAAAAGGG - Intronic
945707936 2:213258873-213258895 CTACTATGATTAGGAGAAAAAGG + Intergenic
945833645 2:214813097-214813119 ACACAATTATTTAGTGAAAGTGG - Intergenic
946615462 2:221504882-221504904 CTAAAAGTTTTTAGTGAAAAAGG + Intronic
948006754 2:234615979-234616001 CTACTTTTATTTACTGATAGAGG - Intergenic
949030203 2:241792198-241792220 TTATTATTATTTAGTAAAGATGG + Intronic
1172541413 20:35720155-35720177 CTAAAATTATTGAGTGGAAAAGG + Intronic
1174268205 20:49347310-49347332 CTAGCATTATTTTGAGAAAAGGG + Intergenic
1174738544 20:52988727-52988749 CTACTTTTGTTTAGTGAAACAGG - Intronic
1174909762 20:54594691-54594713 CTACTACTATTTCCTGTAAATGG - Intronic
1176445992 21:6820976-6820998 ATACCAATATGTAGTGAAAAAGG - Intergenic
1176824159 21:13686009-13686031 ATACCAATATGTAGTGAAAAAGG - Intergenic
1179067835 21:38042756-38042778 TTACTACTATTTAGTGCATATGG - Intronic
1180626159 22:17194777-17194799 TTATTATTATTTACTGAAGAGGG + Intronic
1182161826 22:28130003-28130025 CTACTATTATTTCCTTAACATGG + Intronic
1182750622 22:32639329-32639351 CCAGTATCATTTAGTGAATAAGG + Intronic
951011358 3:17684387-17684409 CTACTGAAATATAGTGAAAATGG - Intronic
951561721 3:23974289-23974311 TTACTATTATTAAGTGTAATAGG + Intronic
956737593 3:72249935-72249957 TTACTATTAATACGTGAAAAAGG - Intergenic
957038634 3:75318522-75318544 CTACTATAATTTATTGGAATAGG + Intergenic
958993010 3:100869523-100869545 CTAATATTATTTTGCAAAAACGG + Intronic
959370852 3:105523216-105523238 TAACTATTATTTATTGAATAAGG + Intronic
960104564 3:113780517-113780539 CTATTATTAGTTTTTGAAAAGGG + Intronic
960412073 3:117339604-117339626 CCAATATTTTTTAGTGATAATGG + Intergenic
961086672 3:124073821-124073843 CTACTATAATTTATTGGAATAGG + Intergenic
963095951 3:141540808-141540830 CAACTAATATTTATTGAATATGG + Intronic
963612816 3:147493598-147493620 CTAATATTATTCAGAGAAAAGGG - Intronic
963757268 3:149248235-149248257 CTATTATTATTTACGCAAAAAGG - Intergenic
964528320 3:157639767-157639789 CCACTTTTATTTAGTGTAAGGGG + Intronic
964579480 3:158216930-158216952 ATGCTAGTCTTTAGTGAAAAAGG - Intronic
964636919 3:158868001-158868023 CCCCTATTATTTAGTGGACAGGG - Intergenic
964715831 3:159720440-159720462 CTTCTAATATTTACTGAGAAGGG - Intronic
965207726 3:165743501-165743523 CTATTATAATTTAGTTAACAGGG + Intergenic
965272980 3:166642246-166642268 GAATTATTTTTTAGTGAAAAGGG + Intergenic
965711558 3:171560752-171560774 ATACTCATATTTAGTAAAAAAGG - Intergenic
966127549 3:176597224-176597246 TTACTATTATTAAGTGAAAATGG - Intergenic
966408345 3:179622444-179622466 TTACTATTTTTTAATGAAATAGG + Intronic
967845593 3:194040259-194040281 CTTGTGTTATTAAGTGAAAATGG - Intergenic
970687142 4:18581399-18581421 ATAAAATTATTTAGTAAAAATGG + Intergenic
972092264 4:35301894-35301916 CTTCACTTATTTGGTGAAAAAGG + Intergenic
972434896 4:39023915-39023937 CTTCTTTTATTTTGTGTAAATGG - Intronic
972758121 4:42072456-42072478 ATACTATTAGATAATGAAAATGG - Intronic
973210203 4:47606792-47606814 TTATTACTGTTTAGTGAAAAAGG - Intronic
973840084 4:54852436-54852458 CCAATATAATTTAGTCAAAATGG - Intergenic
974141227 4:57889775-57889797 CTACTATATTTTTGTGCAAAAGG - Intergenic
975711757 4:77167839-77167861 CTAATATTATTTAGTAAGAGAGG - Exonic
976933101 4:90592977-90592999 ATACAATTATTTTGTGCAAATGG - Intronic
977176288 4:93824351-93824373 CTATAATGATTTTGTGAAAAAGG - Intergenic
978298573 4:107238460-107238482 CTAGTATCATTTATTGAATAGGG + Intronic
978416363 4:108481157-108481179 CTGCAATTATTTAGTGAATTTGG + Intergenic
979602145 4:122597859-122597881 CTAATAATATTAAATGAAAATGG - Intergenic
980309774 4:131111408-131111430 ATTCCATTATTCAGTGAAAATGG + Intergenic
980327708 4:131369669-131369691 CTAATATTATTTATTTAATAAGG + Intergenic
980447431 4:132928711-132928733 CTATTTTCTTTTAGTGAAAACGG + Intergenic
980781015 4:137492430-137492452 CTCCTATAATATAGTGACAAAGG + Intergenic
982706907 4:158720548-158720570 ATACTTTTGTTTAGTGATAATGG - Intronic
983012411 4:162563891-162563913 TTGCTAATATTTAGTGAGAAAGG + Intergenic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983456705 4:167974076-167974098 ATACTAATCTTGAGTGAAAATGG + Intergenic
984559752 4:181254459-181254481 CTTCTGTTATTTGGTGGAAAAGG + Intergenic
986552399 5:8973171-8973193 CTGCTATTATTTAATTAAATGGG + Intergenic
986824859 5:11509432-11509454 TTACTATTATGTAGGAAAAATGG - Intronic
987712254 5:21516026-21516048 CTAGTACAATTTATTGAAAAAGG - Intergenic
987917685 5:24236749-24236771 ATACTATTTTGTAGTGAAAGTGG - Intergenic
987947920 5:24637414-24637436 CTACTACTATTTCATAAAAATGG + Intronic
987994344 5:25255667-25255689 CTACTATTAAATAGTGATCAGGG - Intergenic
988302161 5:29444793-29444815 CTAGTACAATTTATTGAAAAAGG + Intergenic
990357017 5:54978452-54978474 CTAGTATTATTTGTTGAAAATGG - Exonic
991762612 5:69935172-69935194 CTAGTACAATTTATTGAAAAAGG - Intergenic
991784714 5:70182954-70182976 CTAGTATAATTTATTGAAAAAGG + Intergenic
991841840 5:70810212-70810234 CTAGTACAATTTATTGAAAAAGG - Intergenic
991877160 5:71183329-71183351 CTAGTATAATTTATTGAAAAAGG + Intergenic
992053763 5:72966797-72966819 TTATTCTTCTTTAGTGAAAATGG - Intronic
992891618 5:81209397-81209419 TTACTATAGTTTAGTGAAACTGG - Intronic
993243072 5:85415444-85415466 CTACTATTACTTTTTGAAGAAGG - Intergenic
993956747 5:94243579-94243601 CTAATTTTATGTGGTGAAAAAGG + Intronic
994147088 5:96407626-96407648 CAACTAATATTTACTGACAATGG + Intronic
996145725 5:119972929-119972951 ATATTATTATTTAGTTGAAATGG + Intergenic
996559907 5:124817575-124817597 CTAATATTCTGTAGTGTAAAAGG + Intergenic
997037988 5:130215721-130215743 TTACTATTATTTCATTAAAATGG + Intergenic
997681879 5:135762299-135762321 CTGCTGTTATTTGCTGAAAATGG + Intergenic
998975276 5:147638607-147638629 CTACTATTGTTCAGTGGGAAAGG - Intronic
1000411643 5:160939524-160939546 CAACTCTTTTTTAGTGAGAATGG - Intergenic
1001752736 5:174143920-174143942 TTACTATTATTTATTATAAAGGG - Intronic
1002805471 6:569946-569968 CTAGGATATTTTAGTGAAAAGGG - Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004409312 6:15365957-15365979 CTACTGTTACTTTGTTAAAAGGG + Intronic
1005247248 6:23901638-23901660 ATACTAATATTTAAGGAAAATGG - Intergenic
1005464496 6:26099353-26099375 TTTCTATTATTTATTGAAACGGG + Intergenic
1008026270 6:46639735-46639757 CTACTATTATTTGGTCAGCAGGG + Intronic
1008469662 6:51869568-51869590 CCAATACTATTCAGTGAAAAGGG + Intronic
1008611932 6:53192301-53192323 ATACTTTGATTTAATGAAAATGG + Intergenic
1009005401 6:57780366-57780388 CTAGTACAATTTATTGAAAAAGG + Intergenic
1009043042 6:58204462-58204484 CTGCTATTATTTTGTGAAATAGG + Intergenic
1009218877 6:60958714-60958736 CTGCTATTATTTTGTGAAATAGG + Intergenic
1009318861 6:62259519-62259541 CTACTATTATTTATGTACAAGGG - Intronic
1009515780 6:64615311-64615333 CCACTAATCTTTAGTGCAAATGG - Intronic
1009734017 6:67651666-67651688 CTATTATAAATTTGTGAAAATGG + Intergenic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1010354390 6:74914043-74914065 CTATAATTCTTTTGTGAAAACGG - Intergenic
1010579774 6:77581358-77581380 CTACTATTAATTAGAGATAACGG - Intergenic
1010675227 6:78735735-78735757 CCAGTATTATTTATTGAAGAGGG + Intergenic
1011357140 6:86483292-86483314 TTATTATTATTTAGTGGAAATGG + Intergenic
1012568160 6:100686456-100686478 CTACTACCATATGGTGAAAAGGG - Intronic
1013478065 6:110527897-110527919 TTGCTATTATTTAGTGAAACAGG - Intergenic
1013531212 6:111020478-111020500 TCACTTGTATTTAGTGAAAAGGG + Intronic
1014299030 6:119657310-119657332 CTAATATAATTGATTGAAAAGGG - Intergenic
1014348783 6:120312276-120312298 ATACTATTATTTAGTAATAAGGG - Intergenic
1014401288 6:120993585-120993607 CTCCTATTTTACAGTGAAAATGG - Intergenic
1014658429 6:124135278-124135300 ATACTAATATTTAATGTAAATGG + Intronic
1014727896 6:124994965-124994987 CTACTAATATTGTGTAAAAATGG + Intronic
1015564579 6:134555030-134555052 TTACTATTATTGAGGGAAACGGG + Intergenic
1015828557 6:137342687-137342709 CTATCATTATTTAATGGAAAGGG - Intergenic
1015841806 6:137485210-137485232 ATAATATAATTTAGTAAAAATGG + Intergenic
1016039700 6:139420143-139420165 TTATTATTATTTAGAGTAAACGG + Intergenic
1016186440 6:141203267-141203289 CTACAATTAGTGGGTGAAAATGG + Intergenic
1017673516 6:156790881-156790903 CTACAATTAATTACTGAAGAGGG + Intronic
1020714995 7:11662475-11662497 CTTCTATTAGTTAATGAAAGAGG - Intronic
1022243719 7:28536678-28536700 CTACTACTGTTTACTGAACATGG + Intronic
1023896490 7:44437896-44437918 CTACTTTAACTTAGTAAAAATGG + Intronic
1024757345 7:52550754-52550776 CAATTACTATTTAGGGAAAATGG - Intergenic
1026422264 7:70251991-70252013 CCTAAATTATTTAGTGAAAAAGG - Intronic
1026567066 7:71497905-71497927 GTACTATTATTCCATGAAAAGGG + Intronic
1026667002 7:72350175-72350197 CCAGTAATATTTATTGAAAAGGG + Intronic
1028066199 7:86388049-86388071 ATACTATTAATTAATAAAAAAGG - Intergenic
1028262340 7:88681834-88681856 CTACTTTTCTTTTGTGATAAAGG - Intergenic
1028350368 7:89839382-89839404 CAACTAAGTTTTAGTGAAAAGGG - Intergenic
1028445488 7:90917501-90917523 GTATTAATATTTAGGGAAAATGG - Intronic
1028500505 7:91514095-91514117 CCACTCTTATTTAGGGACAAAGG - Intergenic
1028891918 7:95997555-95997577 ATACTAGTATTAATTGAAAAGGG + Intronic
1030449834 7:109694108-109694130 ATACACTTATTTAGTAAAAAAGG - Intergenic
1031526841 7:122832526-122832548 CTACCATTATTTAATGCAGATGG - Intronic
1031753387 7:125606573-125606595 CAACTATTATTTAGTTCCAAAGG + Intergenic
1035861405 8:3032340-3032362 CTACCACTCTTTAGGGAAAATGG - Intronic
1038101604 8:24383394-24383416 GTGCTATTATTTAGCTAAAAAGG - Intergenic
1039105250 8:33982887-33982909 CTTCTAACATTTAGGGAAAAAGG - Intergenic
1042692607 8:71518932-71518954 ATAGTATTATTTAGGAAAAAAGG - Intronic
1042988296 8:74607696-74607718 ATACTATTAATTACTGAAAAAGG - Intronic
1043079409 8:75746906-75746928 CCAGTACTATTTATTGAAAATGG - Intergenic
1044189107 8:89293555-89293577 GTCCTATTCTCTAGTGAAAATGG - Intergenic
1045127556 8:99109313-99109335 CAATTATTATTCAGTGAAAGAGG - Intronic
1045814594 8:106264903-106264925 CTAATATTATGTAATGACAAAGG - Intergenic
1045917607 8:107490964-107490986 CTGCCATTATGTAGTTAAAAAGG + Intronic
1046219505 8:111194684-111194706 CTATTCTTATTTACTGCAAAGGG + Intergenic
1046483869 8:114859467-114859489 CAACTATTATTAACTGAAATAGG + Intergenic
1047622796 8:126624842-126624864 CTATTATTATTTACCTAAAAAGG + Intergenic
1048243924 8:132773194-132773216 CTGCTACTATTTAGTGGGAAGGG - Intergenic
1051096538 9:13472552-13472574 CCAGTATTATTTATTGAATAGGG + Intergenic
1053087675 9:35240561-35240583 CTACTAAAATTTGGTGAAAATGG - Intronic
1058253912 9:102736988-102737010 CTGTTATTATTTATTGACAATGG - Intergenic
1058509373 9:105700305-105700327 CTACTATTATTGTGTAGAAAAGG - Intronic
1058533418 9:105929879-105929901 CCATGATCATTTAGTGAAAATGG - Intergenic
1059789225 9:117622031-117622053 CTATTATTACTTGGTGAAATAGG - Intergenic
1060293165 9:122323026-122323048 ATTTTATTGTTTAGTGAAAATGG - Exonic
1203523201 Un_GL000213v1:63549-63571 ATACCAATATGTAGTGAAAAAGG + Intergenic
1185723026 X:2397005-2397027 CCATTTTTATTTAGAGAAAAGGG + Intronic
1187060924 X:15786582-15786604 CTAGTATTATTTAATGAAGACGG - Exonic
1187955153 X:24510401-24510423 CTTTTATTATTTTGGGAAAATGG - Intronic
1187990183 X:24862295-24862317 CTAATATTAATCAGTGAGAAAGG - Intronic
1188476378 X:30597238-30597260 CTACCATTATTTTTAGAAAAAGG - Intergenic
1188712683 X:33420769-33420791 CCAGTATTATTTATTGAATAAGG - Intergenic
1188780276 X:34275039-34275061 CCAGTACTATTTATTGAAAAAGG + Intergenic
1188800299 X:34521638-34521660 CATCTAATATTAAGTGAAAAGGG + Intergenic
1189584074 X:42439613-42439635 CTATTATCATTTATTGAACAGGG - Intergenic
1189871018 X:45382675-45382697 CCAATACTATTTAGTGAAGAGGG + Intergenic
1190568320 X:51754317-51754339 GTATTATTATTTAGCAAAAATGG - Intergenic
1191225843 X:58042348-58042370 ATACTACCATTTATTGAAAATGG + Intergenic
1191917412 X:66217688-66217710 CTACTAACATTTAATGTAAATGG + Intronic
1192926949 X:75764763-75764785 CTAGCATTATTTATTGAATAGGG - Intergenic
1193286689 X:79722845-79722867 CTATTATTATTTCCTGAAGAGGG - Intergenic
1193498735 X:82245061-82245083 CTAATACTATTTATTTAAAATGG - Intergenic
1193762273 X:85481788-85481810 TAAATATTATTTATTGAAAAGGG + Intergenic
1195643101 X:107198998-107199020 CTACTATTATTTATTGATTCTGG + Intronic
1197103095 X:122679886-122679908 TTACAATTATTTGGAGAAAATGG + Intergenic
1197140906 X:123116521-123116543 ATTTTATTGTTTAGTGAAAATGG + Intergenic
1198328437 X:135597643-135597665 CTTCTGGGATTTAGTGAAAATGG - Intergenic
1199336646 X:146626476-146626498 TTACTTTTTTTTAGTGAGAATGG + Intergenic
1199478363 X:148271145-148271167 CTACTTGTATTTAGAGAAATGGG - Intergenic
1199479147 X:148278621-148278643 CTAGTACTATTTATTGAATAGGG - Intergenic
1201946862 Y:19520101-19520123 CTACTATTATTTACAGAATTTGG + Intergenic