ID: 907368660

View in Genome Browser
Species Human (GRCh38)
Location 1:53982929-53982951
Sequence GTGCCCTATCCAATACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907368660_907368664 4 Left 907368660 1:53982929-53982951 CCATGGGGTATTGGATAGGGCAC No data
Right 907368664 1:53982956-53982978 GAGAGTCTTGCCTCAGTCATGGG No data
907368660_907368665 5 Left 907368660 1:53982929-53982951 CCATGGGGTATTGGATAGGGCAC No data
Right 907368665 1:53982957-53982979 AGAGTCTTGCCTCAGTCATGGGG No data
907368660_907368663 3 Left 907368660 1:53982929-53982951 CCATGGGGTATTGGATAGGGCAC No data
Right 907368663 1:53982955-53982977 GGAGAGTCTTGCCTCAGTCATGG No data
907368660_907368667 21 Left 907368660 1:53982929-53982951 CCATGGGGTATTGGATAGGGCAC No data
Right 907368667 1:53982973-53982995 CATGGGGAATAATTAATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907368660 Original CRISPR GTGCCCTATCCAATACCCCA TGG (reversed) Intergenic
No off target data available for this crispr