ID: 907369451

View in Genome Browser
Species Human (GRCh38)
Location 1:53991423-53991445
Sequence TCTCTTCAATGTGGCACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907369451_907369453 -10 Left 907369451 1:53991423-53991445 CCGCTGGTGCCACATTGAAGAGA No data
Right 907369453 1:53991436-53991458 ATTGAAGAGAACAATTCCCAAGG No data
907369451_907369454 5 Left 907369451 1:53991423-53991445 CCGCTGGTGCCACATTGAAGAGA No data
Right 907369454 1:53991451-53991473 TCCCAAGGAAGAAAAGAAGTTGG No data
907369451_907369456 6 Left 907369451 1:53991423-53991445 CCGCTGGTGCCACATTGAAGAGA No data
Right 907369456 1:53991452-53991474 CCCAAGGAAGAAAAGAAGTTGGG No data
907369451_907369458 23 Left 907369451 1:53991423-53991445 CCGCTGGTGCCACATTGAAGAGA No data
Right 907369458 1:53991469-53991491 GTTGGGAGAACCTCACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907369451 Original CRISPR TCTCTTCAATGTGGCACCAG CGG (reversed) Intergenic