ID: 907369783

View in Genome Browser
Species Human (GRCh38)
Location 1:53993188-53993210
Sequence GGCTGCACACTCTGTGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907369783_907369789 12 Left 907369783 1:53993188-53993210 CCGGCTTCACAGAGTGTGCAGCC No data
Right 907369789 1:53993223-53993245 CCCTGCTGCAGCTGACATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907369783 Original CRISPR GGCTGCACACTCTGTGAAGC CGG (reversed) Intergenic
No off target data available for this crispr