ID: 907372847

View in Genome Browser
Species Human (GRCh38)
Location 1:54014261-54014283
Sequence AATGGTGACCAAGGCGATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907372832_907372847 23 Left 907372832 1:54014215-54014237 CCCTCTCTTGGCCGCCCTGACCT 0: 1
1: 0
2: 1
3: 19
4: 214
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372830_907372847 27 Left 907372830 1:54014211-54014233 CCCACCCTCTCTTGGCCGCCCTG 0: 1
1: 1
2: 1
3: 24
4: 223
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372840_907372847 8 Left 907372840 1:54014230-54014252 CCTGACCTGGGGTGCATGATGGG 0: 1
1: 0
2: 1
3: 22
4: 151
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372838_907372847 9 Left 907372838 1:54014229-54014251 CCCTGACCTGGGGTGCATGATGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372837_907372847 12 Left 907372837 1:54014226-54014248 CCGCCCTGACCTGGGGTGCATGA 0: 1
1: 0
2: 1
3: 10
4: 141
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372831_907372847 26 Left 907372831 1:54014212-54014234 CCACCCTCTCTTGGCCGCCCTGA 0: 1
1: 0
2: 1
3: 23
4: 237
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372833_907372847 22 Left 907372833 1:54014216-54014238 CCTCTCTTGGCCGCCCTGACCTG 0: 1
1: 0
2: 1
3: 25
4: 186
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148
907372842_907372847 3 Left 907372842 1:54014235-54014257 CCTGGGGTGCATGATGGGAGTCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907372847 Original CRISPR AATGGTGACCAAGGCGATGA GGG Exonic
901118691 1:6871827-6871849 AATGGTTACCAAGGTAATGCAGG - Intronic
901710971 1:11114812-11114834 AATGTTGACCAATGCTATGGAGG - Exonic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
904434969 1:30488878-30488900 AATGGTGATGATGGTGATGATGG + Intergenic
906955314 1:50369253-50369275 AATGATGATGATGGCGATGATGG + Intergenic
907090696 1:51722597-51722619 AGTGGTGAACAAGGCGTTGTGGG + Intronic
907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG + Exonic
911549462 1:99262431-99262453 AATGGTGACAAATTCTATGAAGG + Intergenic
916735949 1:167607207-167607229 AATTGTGACCAAAACGCTGATGG + Intergenic
918413142 1:184281600-184281622 GATGGTGAGGAAGGAGATGATGG + Intergenic
918439931 1:184556536-184556558 AATGGTGGCCAAGACGGTGGAGG - Intronic
919754261 1:201056856-201056878 AATCTGGACCAAGGGGATGAGGG - Intronic
924832743 1:247614951-247614973 AATGGTGCCCAAGGCCATGGTGG + Intergenic
1063095236 10:2903226-2903248 AATGGTGAAGAAGCCGAGGACGG + Intergenic
1063753405 10:8977887-8977909 ACTGGTCACCAAGGAGATGACGG - Intergenic
1064425958 10:15229531-15229553 AATGGTGATGATGGTGATGATGG - Intronic
1064776025 10:18778247-18778269 ACTGGTCATAAAGGCGATGATGG + Intergenic
1069871575 10:71536258-71536280 GATGGAGGCCAAGGCAATGAAGG + Intronic
1076858407 10:133128379-133128401 ACAGGTGACCAGGGTGATGATGG - Exonic
1077739796 11:4832894-4832916 CATGGTAGCCAAGGTGATGATGG - Intronic
1078329067 11:10403765-10403787 AATGATGATTAAGTCGATGATGG + Intronic
1078669475 11:13352200-13352222 AATGGAGACTAAGGAGACGATGG + Intronic
1080319680 11:30992284-30992306 AATGGTGACCATGTAGCTGAGGG + Intronic
1080646363 11:34191091-34191113 GATGGTGACCAAGGGGAGGAGGG - Intronic
1083398059 11:62404969-62404991 GACGGTGACAAAGGTGATGAAGG + Intergenic
1084734067 11:71093173-71093195 AATGTTGACCAGGCCGAGGAAGG - Intronic
1085440710 11:76560010-76560032 AGAGGTGACCACGGAGATGATGG - Intergenic
1085921037 11:80957379-80957401 AGTGGTGCCCAAGGCAAGGAGGG + Intergenic
1089212388 11:116814285-116814307 AGTGGTGACCAGGGAGATAATGG + Intergenic
1090309541 11:125722844-125722866 AATGGGGACAAAGGAGAAGAAGG - Intergenic
1091068378 11:132539865-132539887 GATGGTGATCATGGTGATGATGG + Intronic
1094478722 12:30863063-30863085 AATGGTGACCCAGGTTCTGAGGG + Intergenic
1095117498 12:38372436-38372458 AAGAGTGACCAAGGCTATAAGGG - Intergenic
1100868846 12:98888808-98888830 GATGGTGATAAAGGCCATGAAGG - Intronic
1101927292 12:108983337-108983359 AATGGTGACAAAGATGATGATGG - Intronic
1102629277 12:114263192-114263214 AATGGTGAGGAAGGTGTTGATGG - Intergenic
1103924133 12:124414406-124414428 TATGGTGGCGATGGCGATGATGG - Intronic
1104239363 12:126972561-126972583 AGTGGTGTCCTAGGCAATGATGG + Intergenic
1104743960 12:131198947-131198969 GATGGTAACAAAGGTGATGATGG - Intergenic
1104847557 12:131854302-131854324 GATGGTGACTCAGGCGAAGATGG - Intergenic
1104955644 12:132464655-132464677 AATGGTGACACTGGTGATGATGG - Intergenic
1105800252 13:23896820-23896842 AAGGGTGACAAAGGCGATGCAGG - Exonic
1105848762 13:24316148-24316170 AAGGGTGACAAAGGCGATGCAGG + Exonic
1110434598 13:75464946-75464968 AATTGTGATGAAGGCTATGAAGG - Intronic
1112428114 13:99323470-99323492 AAGGCTGACCAAAGCCATGAGGG + Intronic
1112964336 13:105168828-105168850 AATGGTGTTAAAGGCTATGAAGG + Intergenic
1113420355 13:110166249-110166271 AAAGGTGATCAAGGCGATCAAGG - Exonic
1113899129 13:113786507-113786529 AGTGGTGACAATGGTGATGATGG - Intronic
1121299850 14:92861654-92861676 AATGGTGACAAAGGCCAGCAGGG + Intergenic
1121630660 14:95419619-95419641 GATAGTGACCATGGCGATGGAGG + Intronic
1121712774 14:96051839-96051861 AAGGATGACAAAGACGATGAAGG - Intronic
1123479371 15:20616830-20616852 AATGATAGCCAAGGCCATGAGGG - Intergenic
1124504727 15:30262733-30262755 TATGGTGACAAAAGTGATGAAGG - Intergenic
1124738825 15:32275902-32275924 TATGGTGACAAAAGTGATGAAGG + Intergenic
1126174116 15:45719670-45719692 AATGTTGACCTTGGAGATGAGGG + Intergenic
1129691134 15:77714251-77714273 AATGGTAACCATGGTGATGGGGG - Intronic
1133595726 16:7289508-7289530 AATGGTGATGATGACGATGAAGG - Intronic
1134577853 16:15347276-15347298 ATTTCTGACCAATGCGATGAAGG + Intergenic
1134724735 16:16410270-16410292 ATTTCTGACCAATGCGATGAAGG - Intergenic
1134942696 16:18301589-18301611 ATTTCTGACCAATGCGATGAAGG + Intergenic
1135195531 16:20391137-20391159 GATGATGACAATGGCGATGATGG - Intronic
1135195540 16:20391289-20391311 GATGATGACAATGGCGATGATGG - Intronic
1138563327 16:57815259-57815281 AATGGTGCCCAAGGCTGTGGGGG + Intronic
1138710112 16:58961637-58961659 AAAGGTCACCAAGGCAAGGAGGG - Intergenic
1139561360 16:67744416-67744438 TATGGTTACCATGGTGATGATGG - Exonic
1140995499 16:80255161-80255183 GATGGTGACGAAGTTGATGATGG + Intergenic
1141793052 16:86249654-86249676 AATGGTGGCAATGGTGATGAGGG + Intergenic
1141813669 16:86394092-86394114 GATGGTGATGATGGCGATGATGG - Intergenic
1141931809 16:87210125-87210147 AATGGTGATGATGGTGATGATGG + Intronic
1141931846 16:87210407-87210429 AATGGTGATGATGGTGATGATGG + Intronic
1142528530 17:562559-562581 AATGGTGGTCAGGGCGATCATGG + Exonic
1142695367 17:1629903-1629925 CAGGGTGACCAAGGCGATTCTGG - Intergenic
1143916574 17:10297940-10297962 AATAGTGATGAAGGTGATGATGG + Intergenic
1146527803 17:33581735-33581757 ATTGGTGTCCTATGCGATGAAGG + Intronic
1146644263 17:34566673-34566695 AATGGTGACAATGGTGATGGTGG + Intergenic
1148111836 17:45148849-45148871 GTTGGTGAGCAAGGTGATGAGGG - Exonic
1149685311 17:58531593-58531615 AAAGCTGACCCAGGCGAGGATGG + Intronic
1151309721 17:73285770-73285792 GGTGGTTACCATGGCGATGAGGG - Exonic
1153967776 18:10197228-10197250 AATGGTGACCAAGGGTGGGAGGG - Intergenic
1155360645 18:24997113-24997135 AATGGTGACAAACACTATGAAGG - Intergenic
1156785937 18:40915394-40915416 AATGGAGCTCAAGGAGATGATGG - Intergenic
1156862676 18:41856440-41856462 AATGGGGACCAAGAAGATGCTGG - Intergenic
1156913501 18:42438833-42438855 AATGGTGCCCATGGTGATGAGGG - Intergenic
1161881288 19:6955012-6955034 AATGGTGATGATGGTGATGAAGG + Intergenic
1165385910 19:35510606-35510628 AATGGTGACCAAGGCAGCTACGG - Intronic
1167305116 19:48703663-48703685 ACTGGTGACCACGAAGATGAGGG - Exonic
926859939 2:17299073-17299095 AATGGTCACCCTGGCTATGATGG - Intergenic
930910837 2:56627564-56627586 GATGGTGACAAAGAAGATGAAGG - Intergenic
932188672 2:69720314-69720336 AGTGGTCACCAAGGCACTGATGG - Intronic
932287163 2:70545186-70545208 GAAGGAGACCAAGGAGATGAAGG + Intronic
933331673 2:80900080-80900102 AATGGTGACAATGATGATGATGG - Intergenic
940026432 2:149213406-149213428 AATGGAGACCAAAGAAATGAAGG + Intronic
943236904 2:185334056-185334078 GATGGTTACCAAGGCTAGGAGGG - Intergenic
946216466 2:218187571-218187593 AATGGTGACCAGGGGGCTGGAGG + Intergenic
946397461 2:219450179-219450201 AATGGTGTCCAGGAGGATGATGG - Intronic
1170939064 20:20833615-20833637 AATGATGACAAAGGCCATGCTGG + Intergenic
1172114914 20:32568052-32568074 AATGGTGATGATGGTGATGATGG - Intronic
1174168360 20:48600484-48600506 AATGGTGACGATGGTGATAATGG - Intergenic
1174669503 20:52293108-52293130 GATAGTGACGAAGGTGATGATGG - Intergenic
1175906468 20:62382034-62382056 AATGGTGATGATGGTGATGATGG + Intergenic
1178340782 21:31784310-31784332 AATGGTGATGATGGTGATGATGG - Intergenic
1180160639 21:45997445-45997467 AAAGGCTACCGAGGCGATGAGGG + Exonic
1181926150 22:26360424-26360446 AATGATGAGCAAGGCGAACATGG - Intronic
1182006838 22:26967523-26967545 AATGGTGATAATGGTGATGATGG + Intergenic
1182038794 22:27220082-27220104 AATGGGGAACAAGGTGAGGAAGG + Intergenic
1183244109 22:36680354-36680376 AATGGTGATGATGGTGATGATGG - Intronic
1185136149 22:49073867-49073889 AATGGTAATCATGGTGATGATGG - Intergenic
1185136164 22:49073989-49074011 AATGGTGATCACGGTGTTGATGG - Intergenic
1185136178 22:49074139-49074161 AATGGTAATCATGGTGATGATGG - Intergenic
1185136186 22:49074208-49074230 GATGGTGATCACGGTGATGATGG - Intergenic
1185136195 22:49074301-49074323 GATGGTGATCATGGTGATGATGG - Intergenic
953832437 3:46312138-46312160 AATGGAGACCAAGTGGATAATGG - Intergenic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
955545516 3:60024798-60024820 ACTGCTGACCAAGGCTATCAAGG - Intronic
962436534 3:135372127-135372149 ACTGGAGACCAAGGCGAAGTTGG - Intergenic
967155891 3:186692091-186692113 GATGGTGTCCATGGGGATGATGG - Intergenic
967413894 3:189195711-189195733 ATTGGTGTCCAAGGTGTTGATGG + Intronic
967950768 3:194838520-194838542 AATGGTGATGATGGCAATGATGG + Intergenic
969039207 4:4281826-4281848 TATGGTGGCAAAGGCTATGAAGG - Exonic
975871832 4:78787607-78787629 AATGGTGTCTAAGAGGATGAGGG + Intronic
982054201 4:151531208-151531230 AATTATGACCAAGCAGATGAAGG - Intronic
984703374 4:182832660-182832682 ATTGGTTACAAAGGTGATGAAGG + Intergenic
985625291 5:982438-982460 AATGGAGACCAATGCAGTGAAGG - Intergenic
985978851 5:3445938-3445960 GATGGTGATGATGGCGATGATGG + Intergenic
986785114 5:11106946-11106968 AATCGTGACCATGGGGAGGAAGG + Intronic
993803613 5:92375373-92375395 AATGGGCACCAAGGCCAAGAAGG + Intergenic
994380257 5:99062057-99062079 AATGGTGACAAAGGTGATAGTGG + Intergenic
995376923 5:111484289-111484311 AATGGTGCCCAAGGCAGTGGAGG + Exonic
996750925 5:126887899-126887921 AATGGTGGCAAAAGCTATGAAGG - Intronic
997667286 5:135641821-135641843 CATGGTGATGAAGGGGATGATGG - Intergenic
998322663 5:141247074-141247096 AATGGAGACCAGGGAGGTGAGGG - Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999771989 5:154782819-154782841 GCTGGTGACCAAGGTGAGGAGGG + Intronic
1003599119 6:7501654-7501676 AAAGGTGACTGAGGCGATGTAGG + Intergenic
1004211980 6:13657237-13657259 TATGGTTACCATGGGGATGATGG - Exonic
1006295594 6:33168722-33168744 AAGGGTGACCGAGGCGAGGATGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007485741 6:42179350-42179372 AATGGCGAGCAAGACGAGGAGGG + Exonic
1008330608 6:50240439-50240461 AAGGGTGAGCAAAGCGAAGAGGG + Intergenic
1008769377 6:54960900-54960922 AATGGTGGCCATGGGGCTGAGGG + Intergenic
1012182275 6:96169091-96169113 AATGAGTACCAAGGCGCTGAAGG + Intronic
1016356946 6:143228349-143228371 AGTTGTGGCCAAGGCGAAGATGG + Intronic
1017604563 6:156120092-156120114 AATGAAGCCCAAGGCAATGATGG - Intergenic
1018068374 6:160139760-160139782 AATGGTGATGAGGGCTATGAAGG - Exonic
1019288865 7:237433-237455 AATGGTGATGACGGTGATGACGG + Intronic
1019369539 7:653871-653893 GATGGTGATGAAGGTGATGATGG - Intronic
1026231968 7:68492486-68492508 AATGATGACAATGACGATGATGG + Intergenic
1026622654 7:71963670-71963692 AGTGGTGACCAAGGGGGTAAGGG - Intronic
1038482235 8:27909707-27909729 AAAGGTGATCAGGGGGATGAAGG - Exonic
1045512538 8:102823504-102823526 AAAGGGGACCAAAGTGATGAAGG + Intergenic
1050877958 9:10664153-10664175 AATGTTGACCACTGTGATGATGG + Intergenic
1051175603 9:14356503-14356525 AATGGTCAGCAAGGCCCTGAGGG + Intronic
1061511858 9:131066585-131066607 AATGGTGACGATGATGATGAGGG + Intronic
1061736524 9:132664308-132664330 AAGGGTGACCAAGATGATAAAGG - Intronic
1062117227 9:134815950-134815972 CCTGGTGACAAAGGAGATGATGG + Exonic
1187234174 X:17451372-17451394 AATGGTCAGCAAGGTGATGGTGG - Intronic
1191920386 X:66249983-66250005 AATGCTGACCATGGCAGTGAGGG + Intronic
1196989304 X:121310500-121310522 AAAGGTGACCAAGGCTGTGAGGG - Intergenic
1197063871 X:122215746-122215768 AATGATGATGATGGCGATGATGG - Intergenic
1200152101 X:153956299-153956321 AATGGTGCCCAAGGTGGTGATGG + Exonic