ID: 907379399

View in Genome Browser
Species Human (GRCh38)
Location 1:54073428-54073450
Sequence CTGTGGGCCAGTAGCGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907379399_907379404 19 Left 907379399 1:54073428-54073450 CCCTCCTCGCTACTGGCCCACAG 0: 1
1: 0
2: 2
3: 10
4: 173
Right 907379404 1:54073470-54073492 TGCTATTGATATCAGCCCTTAGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907379399 Original CRISPR CTGTGGGCCAGTAGCGAGGA GGG (reversed) Intronic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
902712458 1:18249761-18249783 CTGTGGGCCAGTAGAGGAAAGGG - Intronic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
904441403 1:30534367-30534389 CTGTGGGGCAGTAGGGGGGTGGG - Intergenic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905162533 1:36049185-36049207 CTGTGGACTACTAGAGAGGAGGG + Intronic
905726634 1:40258017-40258039 CTTTGGGCCGGAAGTGAGGAAGG + Intergenic
907379399 1:54073428-54073450 CTGTGGGCCAGTAGCGAGGAGGG - Intronic
915137733 1:153745491-153745513 CTGAAGACCAGTAGCAAGGATGG - Intronic
916076255 1:161201550-161201572 CTGTTGGCCATTACCCAGGAGGG + Intronic
917243513 1:172974904-172974926 ATGTGGGCCTGTAGGCAGGAGGG - Intergenic
918582198 1:186144626-186144648 CTGTGCCCCAGTATGGAGGAAGG + Exonic
918725507 1:187916873-187916895 CATAGGGCCAGTAGCCAGGAAGG + Intergenic
918874383 1:190020678-190020700 GTGTTAGCCAGTAGCCAGGATGG + Intergenic
920196284 1:204229253-204229275 CTTTGGGCCAGCAGAAAGGAAGG - Intronic
922983957 1:229851538-229851560 CTGAGGGCCAGTAGCCTTGAGGG - Intergenic
923181871 1:231528015-231528037 CTGAGAGCCAGTGGAGAGGAGGG + Intergenic
924414848 1:243849420-243849442 CTGCGCGCCAGTGGCGGGGAAGG + Intronic
1063105410 10:2987822-2987844 CTGTGAGCCAGGAGCAGGGAGGG - Intergenic
1068810037 10:61244909-61244931 CCGTGAGCCAGTGGCCAGGAGGG + Intergenic
1070282809 10:75062166-75062188 CTGTGGGCCTGAAGCAAGGAGGG - Intergenic
1071437962 10:85664341-85664363 CTGTGGTCCTGTAGCCAGTAAGG + Intronic
1071893972 10:90044040-90044062 TTGAGGGCCAGTAGGGAGGGCGG - Intergenic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1074705100 10:116123223-116123245 CTGTGGGCTAGGAGCAGGGATGG - Intronic
1075321913 10:121498289-121498311 CTGGGGGCCAGTGGAAAGGAGGG - Intronic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1076234479 10:128853037-128853059 AGGTGGGCCTGTAGCAAGGAAGG + Intergenic
1077414386 11:2418019-2418041 CTGTGGGCCTGAAGCGAGAGTGG + Intronic
1079423923 11:20322335-20322357 CTGTGGTCCTCTAGAGAGGACGG + Intergenic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1082183795 11:49154370-49154392 CTGTGGCCCAGGTTCGAGGAGGG - Exonic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084562803 11:69913878-69913900 CTGTGGGGCCGTAAGGAGGAGGG - Intergenic
1086682564 11:89690982-89691004 CTGTGGCCCAGGTTCGAGGAGGG + Intergenic
1089305248 11:117522350-117522372 CTGTGGGCCACTTGAGAGCAGGG + Intronic
1089603803 11:119630120-119630142 CTGTGGTCCAGAAGCAAGGGTGG + Intronic
1089863506 11:121611609-121611631 CAGAGGGCCAGTAGAGGGGATGG - Intronic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1096274729 12:50196563-50196585 ATGGGGGCCAGTAGAAAGGAGGG - Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1098277677 12:68829988-68830010 CTGTGGGCCATATGCCAGGATGG + Intronic
1102980044 12:117234241-117234263 CTGAGGGCTAGTGGTGAGGATGG + Intronic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1105819048 13:24063462-24063484 ATGTGGGCCAGGGGAGAGGATGG - Intronic
1106812034 13:33368217-33368239 CACTGGGCCAGGATCGAGGAGGG - Intergenic
1111480138 13:88813382-88813404 CTGTAGGCCAGTAAAGAGTAGGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1113225448 13:108154414-108154436 CTGTGGGCCAACAGGGAGGCTGG - Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1124011749 15:25844702-25844724 CGGTGGGCGAGCAGTGAGGAGGG + Intronic
1125343633 15:38697843-38697865 CTGTGTGCCAGTGACGGGGAGGG + Intronic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1128634395 15:69293911-69293933 CTGAGGGCCAGTAGCCATCAAGG - Intergenic
1129682179 15:77664103-77664125 CTGTGTGGCAGAAGAGAGGAAGG - Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1139476829 16:67207020-67207042 CTGTGGGCCAGGCCTGAGGAAGG + Intergenic
1139582552 16:67881978-67882000 CTGAGGGGCAGCAGCGGGGAGGG + Exonic
1141047136 16:80725477-80725499 CTGTGGGCCAGGAGCTATGCTGG - Intronic
1141278371 16:82608113-82608135 CTGGGGGCCATTAGGGAGGCTGG - Intergenic
1141633003 16:85299001-85299023 CTGTCCTCCAGCAGCGAGGACGG - Intergenic
1141695113 16:85615406-85615428 CTGCGGGCCGGGTGCGAGGATGG + Intronic
1142221658 16:88857785-88857807 ATGTGGGCCAGTAAAGAGGATGG - Intronic
1146490774 17:33280062-33280084 CTATGTGCCAGGAGTGAGGAGGG - Intronic
1147155500 17:38542654-38542676 CTGGGAGCCAGTAGGGAGGCAGG + Intronic
1147252388 17:39160788-39160810 CTGTGAGGCAGTAGGAAGGAAGG - Intronic
1147512675 17:41084696-41084718 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1147514868 17:41106043-41106065 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1148072206 17:44915016-44915038 CTGTGAGGCAGAAGTGAGGAGGG - Exonic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148839258 17:50484279-50484301 CAATGGGCCAGCAGGGAGGAGGG - Intronic
1149551162 17:57540921-57540943 CTGCAGGCCAGTAGTGAGCAAGG - Intronic
1150646151 17:66978634-66978656 CTGAGGGCCGGAAGCGAGTACGG - Intronic
1151770783 17:76159256-76159278 ATGTGGGCCAGCACCAAGGAGGG + Intronic
1152511290 17:80790853-80790875 CTGTATGCCAGTAGCCCGGATGG + Intronic
1153826372 18:8878735-8878757 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
1154261560 18:12838550-12838572 CTGGGAGGCAGTAGGGAGGAGGG + Intronic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1155231443 18:23778798-23778820 GTGTGGGCCAGCAGAGAAGATGG + Intronic
1156591238 18:38490973-38490995 CTCTGGGTCAGTGGCAAGGATGG - Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157887525 18:51383334-51383356 CTGTGGGACAGTGGTGGGGATGG + Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1163819467 19:19487727-19487749 CTGTGGGCCAGGCCCCAGGAGGG + Intronic
1165094475 19:33402789-33402811 CTGGGGGCCAGCAGAGAGGCAGG + Intronic
1166918000 19:46208944-46208966 CTGTGGGCAAGAAGAGAGGCGGG + Intergenic
1168523081 19:57068104-57068126 CTGAGGTCCAGTAGCCAGGATGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925154495 2:1639200-1639222 CTGTGGGCCTGTGGCGAGGATGG - Intronic
925636447 2:5945873-5945895 CTGTGGCCCAGCAGTGAGGGAGG + Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
926862263 2:17321723-17321745 CAGGGGGCCAGTAGCAAGAAAGG - Intergenic
931830587 2:66046988-66047010 CTGGGATCCAGTAGGGAGGAAGG + Intergenic
932200080 2:69818443-69818465 ATGTGGGCAAGCAGCCAGGAGGG - Intronic
932842841 2:75099720-75099742 CTGTGAGCCAGTGGCCAGCAGGG - Intronic
935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG + Intergenic
936419589 2:112350474-112350496 CTGTGGACCAGTAAAGAGCAAGG - Intergenic
937447494 2:121971218-121971240 CTGAGGGTGAGTAGCCAGGAGGG - Intergenic
939509913 2:143092447-143092469 TTATGGGCCCGGAGCGAGGAAGG + Intronic
942982754 2:182101842-182101864 CTCTGGGCCAGTAACTAGGTGGG + Intronic
945718300 2:213385583-213385605 CTGTTGGCCAGTAAGGAGGGTGG + Intronic
946756370 2:222951823-222951845 CTGTGGTCCACTAGGGAGGTGGG + Intergenic
947585507 2:231353872-231353894 CTGTGCGACAGTAGTGTGGAGGG - Intronic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948780826 2:240320621-240320643 CTGTGTGACAGCAGCGAGGGAGG - Intergenic
1170063577 20:12286432-12286454 CTGGGGGCCAGTAGAGAATATGG + Intergenic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173741885 20:45407161-45407183 CTGTGCTCCAGCAGCGAGGAGGG - Intronic
1179557177 21:42187156-42187178 CTGTTGGCCAGTCACGAAGAGGG - Intergenic
1181003550 22:19999076-19999098 CTGTGGGGCTGTAGCATGGATGG - Intronic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181263990 22:21619479-21619501 CAGTGGGGCAGAGGCGAGGAGGG - Intronic
1183473932 22:38025613-38025635 CTGTGGGCCAGTGCGTAGGAGGG - Intronic
1184468362 22:44682049-44682071 CAGTGGGCCAGTGGTGAGGCAGG - Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1185120732 22:48968430-48968452 CTGGGGGCCAGTCGTGAGGTGGG - Intergenic
1185302199 22:50087716-50087738 CAGTGGGCAAGTGGTGAGGAGGG + Intergenic
1185399000 22:50606336-50606358 CTGGGGGGCAGTAGGGAGCAGGG + Intronic
949661401 3:6283429-6283451 CTCTGGGCCAGGAGAGAGTAGGG + Intergenic
951405828 3:22296288-22296310 CTGTGTGGCATTAGCGGGGATGG + Intronic
952814134 3:37432077-37432099 CTGTGTGCCAGTACCCAAGAGGG - Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956193546 3:66630147-66630169 CTGTGGGCCAATAGCCAACAAGG + Intergenic
957011476 3:75010503-75010525 ATGAGGGCCATTAGCTAGGATGG - Intergenic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
962096738 3:132300111-132300133 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
963831521 3:150014266-150014288 CTGTGGGCCAGATGGGAGAAGGG + Intronic
965329413 3:167351929-167351951 TTGTGGGCCAGCAACCAGGAAGG - Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969176748 4:5404687-5404709 TTATGGGCCCGGAGCGAGGAGGG - Intronic
974314504 4:60260936-60260958 CTGTGGGCCGGTGAGGAGGAGGG - Intergenic
979504407 4:121479630-121479652 CTGTGGGCCAGCAGTGGTGATGG - Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
995846795 5:116502284-116502306 TTGTGGGCCACAAGCCAGGACGG - Exonic
995927649 5:117394524-117394546 ATTTGGGCCAGTGGCGATGAGGG + Intergenic
996536352 5:124581748-124581770 CTGTGCTCCAGTGGGGAGGAGGG + Intergenic
1000968802 5:167691578-167691600 CTGAGGGACAGAAGCGGGGAAGG - Intronic
1002565582 5:180111417-180111439 CCGTGGCCCAGTAGGCAGGAGGG + Intronic
1003379580 6:5611238-5611260 CTGAGGGCCAGAAGTGAGGTAGG + Intronic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006273742 6:32984517-32984539 CTGTGGGCCAGTAGGGAGCTAGG + Intergenic
1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG + Intergenic
1016994623 6:149953127-149953149 CTGTAGGCCAGTAGCAAAAATGG + Intergenic
1017724854 6:157269692-157269714 GTGTGGGCCAGCGGCCAGGATGG + Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019796761 7:3055512-3055534 ATGGGGGACAGTAGTGAGGAAGG - Intergenic
1022550899 7:31237924-31237946 CTGTGGGCCTGCAGCTAGGGTGG + Intergenic
1022838614 7:34140964-34140986 CCATGGGCCAGGAGAGAGGATGG + Intronic
1024369069 7:48559304-48559326 CTGTGAGCCAGTAGTGATGGTGG - Intronic
1026449189 7:70512428-70512450 CCGGGGGCCAGAAGCAAGGAAGG + Intronic
1027666155 7:81044662-81044684 CAGTGGGCCACTAGCGAGCTGGG - Intergenic
1029251482 7:99239823-99239845 GTGTGGGCCAGCAGAGAGAAGGG - Intergenic
1030087501 7:105829515-105829537 CTATGGGCCAGCATGGAGGAAGG + Intronic
1032170562 7:129581183-129581205 CTGTGGGCCACTAAAGAGCAAGG + Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1035277872 7:157758704-157758726 CTCTGAGCCAGTAGGGTGGATGG - Intronic
1036478648 8:9118092-9118114 CTGTGGGCCAGTGATGACGAGGG + Intergenic
1042873501 8:73419353-73419375 CTGTGAGCAGGTAGAGAGGATGG + Intergenic
1043541031 8:81262677-81262699 CTCTGGTCCAGTAGCCAGAAGGG - Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044184579 8:89236368-89236390 CTGTGGACCACTAAAGAGGAAGG - Intergenic
1044451647 8:92342642-92342664 CTGTGGGCCAGTTGAGAGGAGGG + Intergenic
1044873949 8:96645669-96645691 CTGCGGGACAGCAGCGAGCACGG + Intronic
1045638733 8:104223544-104223566 CAGTGGGCCAGAAGCCAGGTTGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049202142 8:141345672-141345694 CTGCGGGCCAGTGGACAGGAAGG + Intergenic
1050770259 9:9189982-9190004 CACTGTGCCAGGAGCGAGGAAGG - Intronic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1058290773 9:103237896-103237918 CTGCAAGCCAGCAGCGAGGATGG + Intergenic
1059459597 9:114421310-114421332 CTGTGGGCCAGTGCCGAGCTGGG + Intronic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062699544 9:137891738-137891760 CTGTGGGGCTGTAGAGTGGAGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1189384087 X:40522339-40522361 CTGTGGTACAGCAGAGAGGAGGG + Intergenic
1190412939 X:50154888-50154910 TTGTGGGCCAGTAGAAAGGAAGG + Intergenic
1191917971 X:66222594-66222616 CTGTGGACCACTAGAGAGCAAGG - Intronic
1194234311 X:91362973-91362995 CTATGGGCAAATTGCGAGGAAGG + Intergenic
1196206656 X:112947440-112947462 CTGTGGGCCAGAAACTAGGCAGG - Intergenic
1198931533 X:141866582-141866604 CTGTGGGCCTATATCCAGGAAGG - Intronic
1201013444 Y:9573520-9573542 CGGTGAGGCAGTAGCGAGGCTGG - Intergenic