ID: 907379603

View in Genome Browser
Species Human (GRCh38)
Location 1:54075283-54075305
Sequence CTGTGGGAATACAGGGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907379603 Original CRISPR CTGTGGGAATACAGGGGAGA CGG Intronic
900675228 1:3881182-3881204 ATGGGGGAGGACAGGGGAGAAGG + Intronic
901736732 1:11317349-11317371 CTTTGGGAATCCAAGGCAGAAGG - Intergenic
901829943 1:11886251-11886273 GTGTTGGAAAACAGGAGAGATGG + Intergenic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902864452 1:19269146-19269168 CTGAAGGAATGCAGGGGAGTAGG + Intergenic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
903448801 1:23438835-23438857 CTGTGGGAATTTAGGGGCGGAGG + Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904503926 1:30935386-30935408 CTGGAGAAATACAGGGGAAAGGG - Intronic
904708617 1:32411462-32411484 CTCTGGCAGTACAGGGCAGATGG - Intergenic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
906057063 1:42925545-42925567 CTCTGGAAATTCAGGGGTGAAGG + Exonic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907351713 1:53837613-53837635 AGTTTGGAATACAGGGGAGATGG + Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909389050 1:75096701-75096723 CTTTAGGTATAAAGGGGAGAGGG - Intergenic
910990453 1:93050560-93050582 CTGTGCAAATACTGGGGAGTGGG - Intergenic
911187282 1:94916379-94916401 CTGGGGGGAAACAGGGGAGGGGG + Intronic
911689616 1:100818196-100818218 CTTTGGGAACTCAGGGGGGAAGG + Intergenic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
914804664 1:150983315-150983337 CTGTGGGAGCACAGGGTAGTTGG - Intronic
915523876 1:156464485-156464507 CTGTGGGAAACCTGGGGAGGGGG + Exonic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
917899068 1:179523868-179523890 CTTTGGGGATTCAGGGGAAAAGG - Intronic
919243645 1:194948791-194948813 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
919592639 1:199523616-199523638 CTCTGGGAACTCAGGGGAAAGGG - Intergenic
919684144 1:200466322-200466344 CTATGTGAGTACATGGGAGAGGG - Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922191788 1:223325148-223325170 TTGGGGGAAGACAGGAGAGAAGG - Intronic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922597412 1:226824546-226824568 CTGTGGGAGCACGTGGGAGACGG - Intergenic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
1063406568 10:5801431-5801453 CTTTGGGAAGCCAGGGGAGGTGG + Intronic
1063515277 10:6688932-6688954 CTGTGGGAATCCAGGGCAGCGGG + Intergenic
1063658987 10:8020370-8020392 CTGTGGGAATACAGCGGTGGAGG + Intergenic
1063688563 10:8261718-8261740 CTGTGGAATTTCAGGGGAGTGGG - Intergenic
1063955884 10:11266575-11266597 CTGTGGGAAACAAGGGGACAGGG - Intronic
1063971499 10:11384350-11384372 CTGTGGCAAGGCAGTGGAGAAGG + Intergenic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1068067876 10:52154802-52154824 CTTTGGGGACTCAGGGGAGAAGG - Intronic
1068341460 10:55709583-55709605 CTGTCAGAATACAGAGGAAATGG + Intergenic
1068433629 10:56963429-56963451 GTCTGGGCATACAGTGGAGAGGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069863552 10:71486300-71486322 CTCTGGGATTACAGAGGAAAGGG + Intronic
1069906658 10:71736157-71736179 CTGTGGAAATACAGGGGCACAGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072234138 10:93438652-93438674 CTGTGGGAGTAAAGTGGAGGAGG + Intronic
1073514088 10:104061708-104061730 CTGTAGGAGTTCAGGAGAGAAGG - Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074753072 10:116605759-116605781 CTGTGGGAATACAGAAGATAAGG + Intronic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1075508131 10:123044238-123044260 CTGTGGAAAAACAGCGTAGAGGG + Intronic
1076151185 10:128163169-128163191 CTGTGGGAATAAAAGGCGGACGG - Intergenic
1076708814 10:132319689-132319711 CTGTGGGAATGCAGGGGCTGAGG + Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077343229 11:2035285-2035307 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078013463 11:7592260-7592282 TTGTGGGCAGACAGGAGAGAAGG - Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080275957 11:30503719-30503741 ATGGGAGAATAGAGGGGAGAGGG - Intronic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1082952685 11:58834260-58834282 CTGTAAGAATACAGAGGAGAAGG + Exonic
1083373588 11:62201841-62201863 CTTTGGGAATAGGGAGGAGATGG + Intergenic
1083743088 11:64721478-64721500 CTTTTGGGAGACAGGGGAGAAGG - Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085475355 11:76785427-76785449 CTGTGGGAATAACCCGGAGAAGG + Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1086856520 11:91872315-91872337 GGATGGGAATACAGGGGAGAGGG - Intergenic
1088336884 11:108715268-108715290 CTTTGGGAATCCAAGGCAGAAGG + Intronic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1089364127 11:117910648-117910670 GTGTGGGAGTAAAGGGCAGAGGG - Intronic
1089364455 11:117912675-117912697 CTAAGGGCATACAGTGGAGAGGG - Intronic
1090095308 11:123737100-123737122 GTGTTGGAATACAGATGAGAAGG + Intronic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090540333 11:127695541-127695563 CTGGGGAAATACTGGAGAGAGGG + Intergenic
1202826215 11_KI270721v1_random:90474-90496 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1091712494 12:2752007-2752029 ATGTGGGAAAGCAGGGGAGCTGG - Intergenic
1091798306 12:3309595-3309617 CTGTGTGGGTACAGGTGAGAGGG + Intergenic
1092727844 12:11501589-11501611 ATGTGGGAAACCAGGGGAGCTGG + Intergenic
1093027406 12:14257628-14257650 CTCTGGGAAAACAGGAGGGAGGG + Intergenic
1093203340 12:16216532-16216554 CTGTGTAAATATAGGGGATAGGG - Intronic
1093800019 12:23361882-23361904 CTGTCGGAACATAGGGTAGAAGG - Intergenic
1093965483 12:25320346-25320368 CAGAAGGAATACAGAGGAGACGG + Intergenic
1095590899 12:43902579-43902601 CTGTGGGGAGACAAGGGATAGGG + Intronic
1096080765 12:48830855-48830877 CAGTAGGAGGACAGGGGAGATGG - Intronic
1096690078 12:53315186-53315208 CTGTTGGAATATTGAGGAGATGG - Intronic
1097193472 12:57231422-57231444 CTGTGGGAGTCCAGGGGAAGGGG + Intronic
1098213979 12:68196236-68196258 CTTTGGGGATCCAAGGGAGAGGG - Intergenic
1099147398 12:79063936-79063958 CTTTGAGAATACAGAAGAGAGGG - Intronic
1099481369 12:83170437-83170459 TTTTGAGAATGCAGGGGAGAAGG - Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103361279 12:120355865-120355887 CTCTGGGAATTCAGAGGAGGGGG - Intronic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1104009411 12:124918851-124918873 CTGTGGGAGGCCAGGGCAGAAGG - Intergenic
1104849281 12:131863548-131863570 CTATAGGAACACAGGGGTGAGGG - Intergenic
1105572599 13:21617967-21617989 CTGTAGGAATAAAGTGGAGCTGG + Intergenic
1105812073 13:24004480-24004502 CTGTGGCCATCCAGGGGTGAGGG + Intronic
1106183642 13:27389057-27389079 TTCTGGGAATACAAGGGACAGGG - Intergenic
1106365417 13:29074348-29074370 CTGTGGGAGCACACAGGAGAGGG - Intronic
1106605285 13:31223292-31223314 CTGGGGGAATGCAGAGGGGAAGG + Intronic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1107568382 13:41630174-41630196 TTGTGATAATACAGGTGAGAAGG + Intronic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1109609671 13:64747548-64747570 CTGTGGGAGTACAGACTAGAGGG - Intergenic
1109885848 13:68543359-68543381 CTGTGAGATTGCTGGGGAGATGG - Intergenic
1110706825 13:78607340-78607362 TAGTGGGTATACAGGGGAGGGGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115929384 14:38473748-38473770 CTGTGGGAAGCCAAGGCAGAAGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117437373 14:55729541-55729563 CTATGGGAAGGCAGGGGACAGGG + Intergenic
1117568550 14:57021973-57021995 CTTTGGGAGTACAGTGCAGAAGG - Intergenic
1118347078 14:64948284-64948306 CCGTGGGCAGACAGGGGAGCCGG - Exonic
1118646819 14:67848467-67848489 CTGTGGGATTACATGTGAGATGG + Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1121124841 14:91399365-91399387 ATGTGGGAATCCAGGGCTGAGGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1202908880 14_GL000194v1_random:98743-98765 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124438450 15:29670220-29670242 CGGTTGGCAGACAGGGGAGAGGG + Intergenic
1124994613 15:34710829-34710851 CTTTGGGAATCCAATGGAGAAGG + Intergenic
1125120067 15:36145699-36145721 TTCTGGGAATATAGTGGAGAAGG + Intergenic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126335704 15:47584177-47584199 CTTTGGGAGTCCAGGGCAGATGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1128016177 15:64349407-64349429 GTGTGGGTATACTGGGTAGAGGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128342896 15:66835064-66835086 CCATGGGAACACAGGGGAGCCGG + Intergenic
1128388852 15:67169282-67169304 ATTTGGGGTTACAGGGGAGAAGG + Intronic
1128512830 15:68324173-68324195 CTGTGGGAGGCCTGGGGAGAGGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1129665435 15:77576989-77577011 CTGTGGGAAGGCAGGGGCTATGG - Intergenic
1130060834 15:80568858-80568880 CTGATGGAAGGCAGGGGAGATGG - Intronic
1132873611 16:2126195-2126217 CTGTGGGAGTACAGGGGCTCCGG - Intronic
1133023864 16:2979387-2979409 CTGAGGGAGTACAGGGGTGAGGG + Intronic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133836076 16:9368435-9368457 CTTTGGGAACTCAGGGGAAAGGG - Intergenic
1134552698 16:15145369-15145391 CTGTGGGAGTACAGGGGCTCCGG - Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1137620440 16:49873172-49873194 CTGGGGGAATCTGGGGGAGAAGG - Intergenic
1137980891 16:53068610-53068632 ATGAGGGAATACAGTGGAGTGGG - Intronic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1139340504 16:66265022-66265044 CCATGGGACTCCAGGGGAGAAGG + Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140869943 16:79096935-79096957 CTGTGGGCATATTGGGGAGGGGG + Intronic
1140974486 16:80045768-80045790 CGGGGGGAAAGCAGGGGAGAAGG - Intergenic
1141049297 16:80746113-80746135 CTGTTGGAGCCCAGGGGAGAAGG - Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1142763350 17:2053585-2053607 CTATGGGGAGACATGGGAGAGGG + Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142908484 17:3066089-3066111 CTTTGGGAAGACAAGGCAGAAGG - Intergenic
1142926081 17:3238155-3238177 CTTTGGGAAGACAAGGCAGAAGG + Intergenic
1143959900 17:10707988-10708010 ATGTGGGATAACAGGTGAGAAGG + Intronic
1145074287 17:19838573-19838595 CTCTGGGAATACTGGGGGAAAGG + Exonic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147470201 17:40651333-40651355 CTGTGGGAAGAAACGGGTGATGG + Intergenic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148977535 17:51542803-51542825 GTGTGGGGAGACATGGGAGAAGG - Intergenic
1149478683 17:56984549-56984571 CTGTGAGCATCCATGGGAGAGGG - Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152386762 17:79979429-79979451 GTGTGGAAACCCAGGGGAGATGG + Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153643448 18:7174752-7174774 CCGTTGGAAGACAAGGGAGAGGG - Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1156233648 18:35180016-35180038 CCATGGGAAGACAGGAGAGAGGG - Intergenic
1157198865 18:45642259-45642281 CTGAGGGGATACAAGGGATATGG - Intronic
1158597053 18:58825803-58825825 ACGTGGGAATCCAGGGGATATGG + Intergenic
1161266046 19:3365357-3365379 CTGTGGGATTGCTGGGGATAAGG - Intronic
1163020307 19:14478005-14478027 CGCAGGGAATACAGGGGAGAGGG - Exonic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163038145 19:14583460-14583482 CTGGGGGAATACAGGGAATGGGG + Intronic
1163038834 19:14587717-14587739 CTGGGGGAATACAGGGAACGGGG + Intronic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163857947 19:19720780-19720802 CTGTGGGATTATAGGGTAGGTGG - Intronic
1164003197 19:21124996-21125018 CTGTGGGAAGCCAGGGCAGGTGG + Intronic
1164574963 19:29400662-29400684 CTGAGGGCATACTGGGGAGGTGG + Intergenic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165331317 19:35142537-35142559 CTGCGGGTATTCTGGGGAGAGGG + Intronic
1165840936 19:38788953-38788975 CAGTGGGAAGACAGGGGTGGAGG + Intergenic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167498790 19:49834252-49834274 CATTGGGAATGCAGGGGAGGAGG + Intronic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1167721362 19:51182591-51182613 CTGTGGGAGCCCAGCGGAGAGGG - Intergenic
1167763614 19:51464179-51464201 CTGTGGGAGCCCAGCGGAGAGGG + Intergenic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
1167874598 19:52401142-52401164 ATTTTGGAATTCAGGGGAGAGGG - Intronic
1202633540 1_KI270706v1_random:21971-21993 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1202652341 1_KI270707v1_random:18096-18118 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
924978522 2:199031-199053 CTGTGGGAATGCAGGGGGCCAGG - Intergenic
924993856 2:339747-339769 GGGAGGGAGTACAGGGGAGAGGG - Intergenic
924998555 2:385934-385956 CTGTGGGAGGAAAGGGGAGCAGG - Intergenic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
926365509 2:12129615-12129637 CTGTGGAAATAAAGGGTTGAAGG - Intergenic
926646381 2:15294183-15294205 CTCTGGGAATACACAGGAGTGGG + Intronic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
928369727 2:30732236-30732258 ATGGGGAACTACAGGGGAGAGGG + Intronic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
930927590 2:56838208-56838230 CTTTGGGGAAACAGGGGAAAGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932261230 2:70329364-70329386 CTTTGGGAAAACAGGTGAGCTGG + Intergenic
932343811 2:70982816-70982838 CGGTGGGAGTACAGGCGAAAGGG - Intronic
933529168 2:83484311-83484333 TTGTGGAAGTACAGAGGAGAGGG - Intergenic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
935223589 2:101035216-101035238 CTGTGGGAGGCCAGGTGAGAGGG - Intronic
935354050 2:102181706-102181728 ATGTGGGAAGACAGAGGAAAGGG + Intergenic
935714014 2:105924276-105924298 GTCTGGGAATAAAGAGGAGATGG + Intergenic
938121623 2:128638144-128638166 CACTGGGAATACTGGGGAGGGGG + Intergenic
939021695 2:136965082-136965104 CTGTGGGAAAACAATGGAGCAGG - Intronic
941031706 2:160519158-160519180 CTGTGGGAAAAGTTGGGAGAGGG - Intergenic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
942300559 2:174557242-174557264 CTGGGGGAAGACAAAGGAGAAGG + Intergenic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
944089620 2:195891430-195891452 CTGGAGGAATACAGAAGAGAGGG - Intronic
944107867 2:196098925-196098947 GTGTGTGAAGACAGTGGAGAGGG - Intergenic
945000061 2:205339892-205339914 CCCTTGGAAGACAGGGGAGAAGG + Intronic
945754750 2:213832237-213832259 CTTTGGGAGGACAGGGGAGGTGG - Intronic
947371811 2:229454295-229454317 ATGTGGGAATACAGGCCAGAGGG + Intronic
947549328 2:231035391-231035413 TTCTGGGAATACAGGTGTGATGG + Intergenic
1169569227 20:6888362-6888384 CCTTGGGAAAACAGGGGACATGG + Intergenic
1169910254 20:10642356-10642378 CAGTGGGACTACAAGGGAAAGGG - Intronic
1169969718 20:11256380-11256402 CTGTGGGGACTCAGGGGAAAGGG - Intergenic
1170468284 20:16643028-16643050 CTGAAGGACTACAGGGGAGCTGG - Intergenic
1170772580 20:19346675-19346697 CTTTGGGAACTCAGGGGAAAGGG + Intronic
1170783669 20:19449233-19449255 CCCTGGGAATGCAGGGGAGCTGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171340690 20:24425245-24425267 CTGCAGGAACACAGTGGAGATGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1174848348 20:53966462-53966484 CTTTGGGGACTCAGGGGAGAAGG + Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1176599806 21:8781557-8781579 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1179442947 21:41408346-41408368 CTGAGGGAGTACAGTAGAGATGG - Exonic
1180041800 21:45283911-45283933 CTGTGGGAAACCAGGGGGGTAGG - Intronic
1180367173 22:11951319-11951341 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1180378907 22:12120018-12120040 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1183104469 22:35606412-35606434 CTGTGGGAACCCAGAGGAGAGGG - Intergenic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183650100 22:39148857-39148879 CTGTGGGCATTCTGGGGTGATGG - Intronic
1184097556 22:42324871-42324893 CTGAGGGAATACAAGGCACATGG + Intronic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
949266600 3:2164007-2164029 CTTTGGGGATTCAGGGGAAAGGG + Intronic
949760551 3:7465470-7465492 CTCTGGGAACCCAGGTGAGAGGG - Intronic
950264502 3:11564151-11564173 CTGGGGAAATATATGGGAGAAGG - Intronic
950535553 3:13576164-13576186 CTGTGGGAGGACTTGGGAGATGG + Intronic
950881735 3:16328016-16328038 ATGTGGGCATACAGGGTGGAAGG - Intronic
951688582 3:25371947-25371969 CAGTGGGAATATCGGGGTGATGG + Intronic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
954702293 3:52456566-52456588 CTGCGGGAACAAAGGGGAGGAGG - Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954776507 3:53023752-53023774 CTGTAGGAACAAAAGGGAGAAGG - Intronic
954803450 3:53201073-53201095 CTGTGGGCATACAGAGGCGCTGG + Intergenic
955078064 3:55632448-55632470 CTCTGGGAAACCAGGTGAGATGG + Intronic
955684964 3:61540276-61540298 CTGTTGGAATAAGGGGGAGGAGG - Intergenic
957094450 3:75765653-75765675 CTGTGGGAAGCCAGGGGAGGTGG - Intronic
957384361 3:79476746-79476768 CTTTGAGAATTCAGGGGAAAGGG + Intronic
958132314 3:89443721-89443743 CTGGGGGAATACAGTGGTGAAGG + Intronic
959391763 3:105783667-105783689 CAGTGGGAATAAAGCTGAGATGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960121233 3:113950122-113950144 CGGTGGAAACACAGAGGAGAGGG - Intronic
960613614 3:119577516-119577538 CTGTGAGAATCCATGGGAAAGGG - Intergenic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961320250 3:126068159-126068181 CTGTGGCAAGCCAGGGGAGCTGG - Exonic
961602060 3:128069985-128070007 TTGTGGGGAAACAGGTGAGACGG - Exonic
961697810 3:128718093-128718115 CTGTGGGAAAAGAGGAGAAAAGG + Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962456249 3:135568102-135568124 GTTTGGGAATCCAGGGCAGAGGG - Intergenic
964663837 3:159151014-159151036 GTGTGGGAATGCAGGTGGGAAGG + Intronic
964887691 3:161503237-161503259 CTGTGGAGATTCTGGGGAGAGGG + Exonic
966229425 3:177634971-177634993 CTTTGGGGATTCAGGGGAAATGG - Intergenic
966296491 3:178429719-178429741 CTCTGGGAATACAGATGAGTGGG - Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969443524 4:7231692-7231714 CGGTGGGGACACAGAGGAGAGGG + Intronic
970142333 4:12996168-12996190 CTGCAGGGATATAGGGGAGATGG - Intergenic
970825304 4:20265817-20265839 CTCAGGGAATACAGGTGAAAAGG + Intronic
972072654 4:35039748-35039770 AGCTGGGAATACAGGAGAGATGG - Intergenic
973199024 4:47478825-47478847 CTGTTGGAACACAGGCCAGACGG + Intergenic
973363164 4:49183979-49184001 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
973397929 4:49612881-49612903 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
974074002 4:57152047-57152069 CTGTAGGAACTCAGGGGAAAGGG - Intergenic
974298558 4:60035480-60035502 CTATGGGAATACAGCAGAGGAGG - Intergenic
974583212 4:63834331-63834353 CTTTGGGAACTCAGGGGAAAAGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
982298129 4:153851021-153851043 CTGTAGGAAAACAGGGGAAGGGG + Intergenic
982866800 4:160523481-160523503 GTGTGGAAATAAAGGGTAGATGG + Intergenic
983153120 4:164310317-164310339 CTTTGGGAATACAAGGTAGGCGG - Intronic
983996353 4:174187487-174187509 CTTTGGGAATTCAGGGGAAGAGG + Intergenic
984391458 4:179139220-179139242 ATGTTGGAATAGAGGGGTGATGG - Intergenic
984670320 4:182476805-182476827 CTGTGAGACAACAGGAGAGATGG - Intronic
984943629 4:184954643-184954665 CTGTGAGGACACCGGGGAGACGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
1202760525 4_GL000008v2_random:105497-105519 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985589434 5:756976-756998 CTGTGGGGGCACTGGGGAGAGGG + Intronic
986007794 5:3682841-3682863 CTCTGGGGACTCAGGGGAGAGGG - Intergenic
986155162 5:5166916-5166938 CTGTGAGCATACAGGAGGGAAGG - Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986664229 5:10086201-10086223 CTCTGAGAATTCAGAGGAGATGG + Intergenic
987027190 5:13939514-13939536 CTGTGGGAAGACAGGGAAACAGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
992134250 5:73727216-73727238 CTGTGGGAATACTAAGAAGATGG + Intronic
992412906 5:76524491-76524513 TTGTGGGAAAACAGAAGAGAAGG + Intronic
993918906 5:93775680-93775702 CTGTGGGAAAACATGCAAGATGG - Intronic
994097772 5:95862613-95862635 CTGTGGGAATAAAAAGCAGAGGG - Intergenic
994714717 5:103307415-103307437 CAGTGGGAGGACAGAGGAGAAGG - Intergenic
995234147 5:109807122-109807144 CCTTGTGAATACAGGAGAGAGGG + Intronic
995420914 5:111965590-111965612 CTAGGGGAAGATAGGGGAGATGG - Intronic
995495790 5:112741483-112741505 GTGTGAGAATAAAGGGGAGAAGG - Intronic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
998478234 5:142439522-142439544 ATGTATGAATAAAGGGGAGAGGG + Intergenic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
998893151 5:146768315-146768337 CTTTGGGAGTCCAGGGCAGATGG - Intronic
998996812 5:147875056-147875078 CTGAAGGAAGACAGGAGAGATGG + Intronic
1001733223 5:173975498-173975520 CTTTGGGAACTCAGGGGAAAGGG - Intronic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1003851810 6:10231609-10231631 CTTTGGGAATTCAGGGGGAAGGG + Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006924638 6:37647757-37647779 GTGTGGGAGAACAGGGGAGAAGG + Intronic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007207634 6:40165385-40165407 CTGTGGGAATACACAGAAGGTGG + Intergenic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1008855769 6:56085089-56085111 CTGTGGGAAAATGGGGGAAATGG - Intronic
1009883425 6:69597227-69597249 CTGATGGAATAAAGGTGAGATGG + Intergenic
1010318337 6:74476297-74476319 CACTGGGAATACAGAGGTGATGG + Intergenic
1012259682 6:97073145-97073167 ATGAGGGAAGACAGGGGTGAGGG - Intronic
1013757635 6:113480263-113480285 CAATAGGAATAAAGGGGAGATGG + Intergenic
1015380021 6:132556437-132556459 CTTTGGGGACTCAGGGGAGAAGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1018012365 6:159683096-159683118 CTTTGGGAATACAGAGCAGTTGG + Intronic
1018847049 6:167563233-167563255 ATGAGGGAATCCAGGGGTGAGGG - Intergenic
1018847063 6:167563281-167563303 ATGAGGGAATCCAGGGGTGAGGG - Intergenic
1018847121 6:167563513-167563535 ATGAGGGAATCCAGGGGTGAGGG - Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1019703872 7:2488243-2488265 CTCTGGGAAAACAGGGGTGCTGG - Intergenic
1019844994 7:3489753-3489775 TTGTGTGAATACAGATGAGATGG + Intronic
1021605618 7:22406538-22406560 CTGGGGAAATCCAGGGGAAAAGG - Intergenic
1021883760 7:25118558-25118580 CTTTGGGAGGACAGGGCAGATGG - Intergenic
1022547238 7:31200756-31200778 CTGTGGGAAGACAATGAAGATGG + Intergenic
1022766903 7:33423288-33423310 CTGTGGGAATACAGCAGGGGAGG + Intronic
1023582993 7:41701362-41701384 CTGATGGGATCCAGGGGAGATGG + Intronic
1023864864 7:44233813-44233835 CTGAGGGAACACAGAGGTGACGG + Intronic
1024224475 7:47315168-47315190 TTGTGGGAATTAAGGGCAGAAGG - Intronic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1026001487 7:66562195-66562217 CTTTGGGAAGTCAGGGCAGAAGG - Intergenic
1026218055 7:68366993-68367015 CTTTGGGAATTCAGAGGAAAGGG - Intergenic
1026383349 7:69821143-69821165 CTGTGTGTATACTGGAGAGAGGG + Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026982698 7:74536058-74536080 CTGGGGGAATCCCGGGGATAGGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028658230 7:93235481-93235503 CTGTGGTAATCCAGGTGAGAGGG + Intronic
1028903485 7:96126789-96126811 ATTTGGGAAGACAGGAGAGATGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1033651461 7:143346673-143346695 GTTTGGGGATACAGGGGAAAGGG + Intronic
1033890497 7:146006864-146006886 CTTTGGGGACACAGGGGAAAGGG + Intergenic
1034205299 7:149309374-149309396 CTCTTGGAATACAGAGGAGAGGG - Intergenic
1034459619 7:151191303-151191325 CCTTGGGAATGCAGGAGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1036959112 8:13224699-13224721 CTGTGCTAATACTGAGGAGAGGG - Intronic
1037320338 8:17635295-17635317 CTTTGGGGATTCAGGGGAAAGGG - Intronic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1039466636 8:37789307-37789329 TGGAGGGAGTACAGGGGAGAAGG - Intronic
1039934888 8:42033649-42033671 CTGTGGAAACACAGAGGAGGGGG - Intronic
1040389280 8:46935774-46935796 CTGCAGGAATACAGAGGAGCAGG - Intergenic
1040906091 8:52471265-52471287 CTTTGGGAATTCAGGGGGAAGGG - Intergenic
1044537974 8:93379388-93379410 CTCTGGGAATGCAGGCGAAAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044985360 8:97752145-97752167 CTTTGGGAGTACAGCGCAGAAGG - Intergenic
1045117336 8:98997553-98997575 CTGGAGGAAGACAGAGGAGAGGG + Intergenic
1046250857 8:111629144-111629166 CTTTGGGAATTCAGGGGCAAAGG + Intergenic
1046766619 8:118076057-118076079 CTGAGATAATTCAGGGGAGAGGG + Intronic
1047593638 8:126353873-126353895 CTTTGGGAACTCAGGGGAAAGGG + Intergenic
1047606824 8:126482901-126482923 CTTTGGGAACTCAGGGGAAATGG - Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1049001819 8:139831106-139831128 CAGTGGGCAAACAGGAGAGAGGG + Intronic
1049027557 8:140005633-140005655 TTTTGGGAAGACAAGGGAGAAGG + Intronic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049754571 8:144304130-144304152 ATTTGGGAATTGAGGGGAGAAGG + Intronic
1049776555 8:144408604-144408626 CTGCGGGAATAAAGGAGTGAAGG - Intronic
1049828782 8:144686763-144686785 CTAAGTGAATACAGTGGAGAGGG - Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053163804 9:35830731-35830753 TTGTGGGCAGACCGGGGAGAAGG - Intronic
1054360257 9:64107327-64107349 ATGTGTGAATACAGCTGAGAAGG - Intergenic
1055656383 9:78453760-78453782 ATGTAGGAAAACAGGGGATATGG + Intergenic
1056810263 9:89758346-89758368 CTGTGGAAACGCAGGGGACACGG - Intergenic
1056970478 9:91196703-91196725 CTGTGGAAAGACAGGGGAGCCGG - Intergenic
1056982137 9:91324257-91324279 CTGTGGGAAGACGAGGGAGGAGG + Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057479212 9:95431025-95431047 TTGAGGGAATACCTGGGAGAAGG - Intergenic
1058480514 9:105388890-105388912 CTCCAGGAATTCAGGGGAGAAGG + Intronic
1058533081 9:105926131-105926153 CTGTGGGAATAGGGGAGCGAAGG + Intergenic
1058553059 9:106136386-106136408 CTGTGAGAATGCATGGGAGGAGG - Intergenic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059554281 9:115263223-115263245 CTGTGGGAACACAAAGGAGGGGG + Intronic
1059996562 9:119915900-119915922 CTGTGGAAAGACTGGGGAGTTGG - Intergenic
1060229630 9:121817270-121817292 ATGTGGGAATGAAGGGGAGGTGG + Intergenic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1061274593 9:129562121-129562143 CAGTGGGAAGGCAGGGGTGAGGG + Intergenic
1061594832 9:131622054-131622076 CTGTGGGAAGAATGGGGGGAGGG - Intronic
1061994924 9:134178428-134178450 CTGAGGGATGTCAGGGGAGAAGG + Intergenic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062094430 9:134695590-134695612 CTATGGGGGTACAGGGGAGTGGG - Intronic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1203709770 Un_KI270742v1:87160-87182 CTGTGGGAGTCCAAGGGAGGTGG - Intergenic
1203541297 Un_KI270743v1:90383-90405 CTGTGGGAGTCCAAGGGAGGTGG + Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186405828 X:9301472-9301494 CTGAGGGAGGACAGGGGAAAAGG + Intergenic
1187428961 X:19204048-19204070 CTGTGGGAAGACAGTGGATATGG - Intergenic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1189128792 X:38477171-38477193 CTTTGGGGACACAGGGGAAAGGG - Intronic
1189238259 X:39505551-39505573 GTGTGGGAAGACAGATGAGAAGG - Intergenic
1189269052 X:39737477-39737499 CTGTAGGGAGACAGAGGAGAGGG - Intergenic
1191918604 X:66229435-66229457 CTTTGGGGATTCAGGGGAAAGGG + Intronic
1193281758 X:79659377-79659399 CTTTGGGGACACAGGGGAAAGGG - Intergenic
1194672695 X:96754234-96754256 CTTTGGAAACACAGGGCAGATGG - Intronic
1194978233 X:100414048-100414070 CTTTGGGAGGCCAGGGGAGAAGG - Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195941036 X:110168184-110168206 CGGTGGGCATACAGGGGAAGAGG - Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196181625 X:112698305-112698327 CTGTGGTAATCCAGTGTAGATGG + Intergenic
1196809771 X:119619790-119619812 GTGGGGGAAGACAGGGGGGATGG + Intronic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic
1200044759 X:153395600-153395622 CTGTGGGAAACTAGGGGAGGGGG - Intergenic
1200170079 X:154066199-154066221 CTTTGGGAGTACAAGGCAGATGG - Intronic