ID: 907379783

View in Genome Browser
Species Human (GRCh38)
Location 1:54076981-54077003
Sequence ACATTTGAGCAGAAACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1797
Summary {0: 2, 1: 19, 2: 113, 3: 438, 4: 1225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907379782_907379783 -8 Left 907379782 1:54076966-54076988 CCTCATTGAGAGATGACATTTGA No data
Right 907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG 0: 2
1: 19
2: 113
3: 438
4: 1225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907379783 Original CRISPR ACATTTGAGCAGAAACTTGA AGG Intronic
900011678 1:116755-116777 ACATTTAAGAATAGACTTGAAGG - Intergenic
900027782 1:293321-293343 ACATTTAAGAATAGACTTGAAGG - Intergenic
900041737 1:472762-472784 ACATTTAAGAATAGACTTGAAGG - Intergenic
900063172 1:707740-707762 ACATTTAAGAATAGACTTGAAGG - Intergenic
900510611 1:3058511-3058533 ACATTTGGGCAGAGACGTCAGGG - Intergenic
900783293 1:4631700-4631722 ACCTCTGAGCAGAGGCTTGATGG - Intergenic
901177712 1:7316843-7316865 GCTTTTGAGCTGAAACTTGAGGG + Intronic
901271747 1:7957389-7957411 ACATTTAAGAAGAAACTTTTAGG - Intronic
901749372 1:11396509-11396531 ACATTTGCACAAAGACTTGAAGG - Intergenic
902148876 1:14426241-14426263 ACATTTGAGCTGAGCCCTGAAGG - Intergenic
902187616 1:14737139-14737161 ACATTTGAGCAGAGATGTGAAGG + Intronic
902258004 1:15203198-15203220 ATATCTGAGCAGAGATTTGAAGG - Intronic
902308253 1:15560207-15560229 ACATTTCAGCTGAGACCTGAAGG + Intronic
902469940 1:16642314-16642336 ACATTTTAGCAGAAACTTAGAGG - Intergenic
902655969 1:17868648-17868670 ACATTTAAGCAAAGACTTGAAGG + Intergenic
902672958 1:17987753-17987775 AGGTTTGAGGAGAAAGTTGAAGG - Intergenic
903038022 1:20507419-20507441 ACATTTGAGCAGAGCCTAGGAGG - Intronic
903307906 1:22426650-22426672 ACATTTGAGCGGAGACATGAAGG + Intergenic
903528384 1:24010680-24010702 CCATTTGAGCCGAGACCTGAAGG + Intergenic
903678342 1:25080723-25080745 ACTTTTGGGCAGAAGCTTTAGGG - Intergenic
903681841 1:25102670-25102692 ACATTTGAGGAAAAACAGGATGG - Intergenic
903746609 1:25591125-25591147 ACATTTGTACAGAAACCTGAAGG - Intergenic
904199414 1:28810342-28810364 ATATTTAAGCTGAAATTTGAGGG + Intergenic
904257804 1:29267470-29267492 ACATTTGAGCAGAGATCTGAAGG + Intronic
904378213 1:30094951-30094973 GCATTTGAACAGAAACAGGAGGG - Intergenic
904584451 1:31572181-31572203 ACGTTTGAGCTGACACCTGAGGG - Intergenic
904592776 1:31624489-31624511 ACATTTGAGCAGAGACTTGAAGG + Intronic
904796953 1:33063440-33063462 ACATTTGAACAAAGACTTGCAGG + Intronic
904805123 1:33125820-33125842 ACATTTGAGCAAAGACCTGAAGG - Intergenic
904840985 1:33371620-33371642 ACACTGGAGCTGACACTTGAAGG - Intronic
904908976 1:33920102-33920124 ACATTTGAGCCAAGACTTGAAGG + Intronic
904953208 1:34261145-34261167 GCATTTGAACTGAGACTTGAAGG + Intergenic
905224971 1:36472942-36472964 ACAATTGAGCAGATCCTTGAAGG - Intronic
905267630 1:36765653-36765675 GCATTTGAGCTGAGATTTGAAGG + Intergenic
905343811 1:37297892-37297914 ACATTTGAGCAGAGCCTGGGAGG + Intergenic
905500912 1:38435571-38435593 ACATTTGAACTGAATCTTGAGGG + Intergenic
905805015 1:40870066-40870088 ATATTTGAGCAAAAACCTAAAGG + Intergenic
905807640 1:40888381-40888403 ACATTTGAACAGAAATTTGAAGG - Intergenic
905935064 1:41816890-41816912 ACACTTGAGCTGAATCTGGAAGG - Intronic
906007590 1:42490028-42490050 ACATTTAAGCAGAAACTCCTAGG + Intronic
906098068 1:43237597-43237619 GCATTTGAGCTGAGCCTTGAAGG + Intronic
906551512 1:46669718-46669740 ACACTTGAGCAGAGACCTGAAGG + Intronic
906567268 1:46810143-46810165 ACATTTAAGGTGAAACTTGAAGG - Intronic
906660732 1:47579544-47579566 ACATTTGAGCTGAGAGCTGAAGG - Intergenic
906672091 1:47663682-47663704 ACATTTGAGGAAAGCCTTGATGG + Intergenic
906672307 1:47665283-47665305 ACATTTGAGCCAAATCGTGAAGG - Intergenic
906794730 1:48687853-48687875 ATGCTTGAGCAGAAACTTCAGGG - Intronic
906811027 1:48827050-48827072 GCATTTGTCCAGAATCTTGAAGG - Intronic
906891238 1:49717485-49717507 AAATTTGAGCAGTTACTTGAAGG - Intronic
906922035 1:50075066-50075088 ACATTTAAGCAGAGACATAATGG + Intronic
906923760 1:50092281-50092303 ACATTTGAGCTGAATCTTATAGG + Intronic
906941611 1:50260529-50260551 ACATCTGAGCAAAAACTTGGGGG + Intergenic
907061232 1:51428040-51428062 ATTTCTCAGCAGAAACTTGAAGG + Intronic
907174168 1:52502396-52502418 ACTTTTAAGCTGTAACTTGAAGG - Intronic
907175729 1:52520650-52520672 ACATTAGAGCAAATACTTGAAGG - Intronic
907250242 1:53133325-53133347 GCATTTCAGCAGAGCCTTGAAGG + Intronic
907264786 1:53251048-53251070 ACATTTGAACAGGATCTTGAAGG - Intronic
907322522 1:53614336-53614358 ACATTTGAACAGAGGCCTGAGGG + Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
907526677 1:55057774-55057796 ACATTTGATCGGGAGCTTGATGG + Intronic
907615686 1:55923532-55923554 ATATTTGTGTAAAAACTTGAAGG + Intergenic
907661042 1:56392644-56392666 ACATTTGAGCTGAGACTTGAGGG - Intergenic
907719423 1:56957904-56957926 ACACCTCAGCTGAAACTTGATGG + Intronic
907788192 1:57634932-57634954 GCATTTGAGCAGAGATCTGAAGG + Intronic
907898995 1:58720215-58720237 ACATTTGAGGAAAGATTTGAAGG - Intergenic
907905295 1:58779106-58779128 ACATGCAAGCAGAAACATGAAGG + Intergenic
907990753 1:59580062-59580084 ACATTACAGCAGAGACTGGAAGG - Intronic
908170262 1:61497437-61497459 CCATTTGAGCAGGAATTTCAGGG + Intergenic
908190743 1:61701411-61701433 ATATTTGAGCAGAGACCTGAGGG + Intronic
908351799 1:63293270-63293292 ACATTTGAGCAAAGATTTTAAGG - Intergenic
908447325 1:64212155-64212177 ACATTTGAGCAAAAAATTTAAGG + Intronic
908569734 1:65396557-65396579 ACATTTGAGCAAACACTTGAAGG - Intronic
908886468 1:68795073-68795095 ACATTTGGGATGAGACTTGAAGG - Intergenic
908923359 1:69223207-69223229 ATATTTGAGCAGAGACCTAAAGG + Intergenic
908986577 1:70031003-70031025 GCCTTTAAGCTGAAACTTGAAGG - Intronic
909087827 1:71188360-71188382 ACATTTAAGCAGAAATCTGAAGG - Intergenic
909152727 1:72028692-72028714 ATATTTCAGCAGAATCTTGAAGG - Intronic
909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG + Intronic
909294841 1:73934617-73934639 ACATTTGAGTAAAGACTGGAAGG + Intergenic
909624754 1:77703272-77703294 ACATTTAAGCAAAGACTTAAAGG - Intronic
909680709 1:78288198-78288220 ACATTTGAGCAGAGACCTGTAGG - Intergenic
909900689 1:81131043-81131065 TCATTTGAGCAAACACCTGAAGG - Intergenic
910088120 1:83428474-83428496 GCATTTGAACTGAAACCTGAAGG + Intergenic
910103775 1:83608069-83608091 GTATTTGAGTAGAAACCTGATGG + Intergenic
910181287 1:84486000-84486022 ACCTTTTAGCAAAGACTTGAAGG + Intronic
910200770 1:84696178-84696200 ACATTTGAGCAGACTCTAAAGGG - Intergenic
910238025 1:85055881-85055903 ACATCTTAGCAAAAACTTGAAGG + Intronic
910242126 1:85098650-85098672 ACATTTGAGGTGAGACTTGATGG + Exonic
910253541 1:85222991-85223013 ATATTTGAGCTGACACTTGAAGG - Intergenic
910340280 1:86179315-86179337 AGATTTGAGCAGCAACTAGAAGG + Intergenic
910552920 1:88497336-88497358 ACATTAAAGTAGAAACTTCAGGG - Intergenic
910825364 1:91401390-91401412 ACATTTGACCTATAACTTGAAGG - Intronic
910835514 1:91505086-91505108 ACATTTGAGCTAAGACTTCAAGG + Intronic
910922587 1:92365090-92365112 ACATTTGAACTGGATCTTGAAGG - Intronic
911170343 1:94764782-94764804 ACATTTGAGTAAGGACTTGAAGG - Intergenic
911357048 1:96835509-96835531 ACATTTGAGCAGCATTCTGAAGG + Intergenic
911585347 1:99683927-99683949 TCATTTGAGCAGAGACATGAAGG - Intronic
911710516 1:101066496-101066518 TGATTTGAGCAGAGACCTGAAGG + Intergenic
912127510 1:106557027-106557049 ACTTTTCAGCAGAAACCTCATGG + Intergenic
912168626 1:107070110-107070132 GCATTTAAGCAGGATCTTGAAGG - Intergenic
912310567 1:108616984-108617006 ATATTTGAGTAGAGACCTGAAGG + Intronic
912372702 1:109186163-109186185 ACATTTGAGCAGAGACCTGAAGG + Intronic
912391150 1:109303977-109303999 ACATTTGAGCAGCAACTTAAAGG - Intronic
912697642 1:111853480-111853502 ACATTTGAGCAAAAATGTGAAGG - Intronic
912714860 1:111975902-111975924 ATATTCGAGCAGAGACCTGAAGG - Intronic
912728352 1:112078970-112078992 ACATTTGAGCAGAGAACTGAAGG + Intergenic
912739572 1:112181722-112181744 ACATTTAAGCTGCAACCTGAAGG + Intergenic
912793899 1:112678598-112678620 ATATTTGAGTAGAATCTTGAAGG + Intronic
912917757 1:113833943-113833965 ACATTTGAGCTGATTCTTGAAGG - Intronic
913164802 1:116175231-116175253 ACATCTGAGCAGAAACCTGAAGG + Intergenic
913274948 1:117127921-117127943 ATATTTGAGCAAACACTTAAAGG + Intergenic
913319929 1:117581083-117581105 ACATTTGAGCTGAGTTTTGAAGG + Intergenic
913688952 1:121260228-121260250 ACATTTGTGCAAAAATTTAAAGG + Intronic
914148648 1:145020049-145020071 ACATTTGTGCAAAAATTTAAAGG - Intronic
914330853 1:146670015-146670037 ACATTTGAGTGGAGACTTGAAGG + Intergenic
914452488 1:147805084-147805106 ACATTGGAGCAAAAACTGGAGGG + Intergenic
914506225 1:148291531-148291553 ACATTTGAGTGAAGACTTGAAGG + Intergenic
914685527 1:149975587-149975609 ACATTTGAGCTGAATCTTGAAGG + Intronic
914778753 1:150763947-150763969 CCATTTGAGCAGAGAATTGATGG - Intronic
914963491 1:152228871-152228893 GTATTTGAGCAGAGACTTGAAGG - Intergenic
915485107 1:156214822-156214844 GCATTTCAGCTGGAACTTGAAGG + Intronic
915496111 1:156283814-156283836 ATATTTGAGCTGAAACCTGATGG - Intronic
915721819 1:157991536-157991558 ACATTTGGGCACAGACCTGAAGG - Intergenic
916062865 1:161113285-161113307 GTATTTGAGCAGAACCCTGAAGG - Intronic
916464591 1:165061580-165061602 AGAGTTGAGCAAAGACTTGAGGG + Intergenic
916474325 1:165154137-165154159 ACATTTGATCAGGGTCTTGAAGG - Intergenic
916511305 1:165474474-165474496 ACATTTGAGCAAAAATTTGAAGG + Intergenic
916573205 1:166045243-166045265 ACATTTGACCAAAGACTTGAAGG + Intergenic
916628176 1:166582350-166582372 ACATTTGAGCAAACATCTGAAGG - Intergenic
916757929 1:167791014-167791036 ACATTTGAGCAGAGGCTTAAAGG - Exonic
917166199 1:172115730-172115752 ACATTTCAGCAGAGACCTGAAGG - Intronic
917192077 1:172428608-172428630 ACATTTTACCAAAGACTTGAAGG - Intronic
917270399 1:173266510-173266532 ATATTTGAGAAGAATCTTAAGGG - Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
917768879 1:178254076-178254098 TCATTGGAGCAGAAATATGATGG - Intronic
917839104 1:178963216-178963238 AAATTTGAGCAAAGACTTGAAGG + Intergenic
918096057 1:181335094-181335116 ACATTTGAGCAAAGACCTGAAGG - Intergenic
918099887 1:181364157-181364179 AAATCTGAGCAAAAACCTGAAGG - Intergenic
918252338 1:182714134-182714156 ACATTTAAGCTGAAACCTGTAGG - Intergenic
918319996 1:183355175-183355197 GCATTTGAACAGAGCCTTGAAGG - Intronic
918359856 1:183745799-183745821 AAAATTAAGCAGAAACTTGTTGG + Intronic
918366976 1:183818458-183818480 ACATTTGAGCTGCAACTTAAAGG - Intronic
918550788 1:185739904-185739926 ACATTTGATCAAAGACTTGAAGG + Intronic
918634895 1:186764042-186764064 ACATTTGGACAAAGACTTGAAGG - Intergenic
918711117 1:187731554-187731576 ACATTTGAGCAGAGATCTGAAGG - Intergenic
918838390 1:189500607-189500629 ACATTTGAGCAAAGACAGGAAGG - Intergenic
918888789 1:190235721-190235743 AAATTTGAGCAAAAATTTGAAGG - Intronic
918992372 1:191714117-191714139 AACTTTGAGCAGAAACATTAGGG + Intergenic
919179951 1:194067887-194067909 ACATCTGACCACAAACTTCAGGG - Intergenic
919244165 1:194955985-194956007 ACATTTGAGCAGCAACTTCAAGG - Intergenic
919432718 1:197516916-197516938 ACATTTGAGCTGGATGTTGAAGG - Intronic
919606781 1:199693207-199693229 ACATTTGAGAAAAGACCTGAGGG + Intergenic
919647702 1:200112206-200112228 ACATTTGAGCAAAGTCTTAAAGG + Intronic
920036135 1:203067062-203067084 ACATTTAAGCAAAGACTTAATGG + Intronic
920060460 1:203223585-203223607 GTATTTGCGCAGAAACCTGATGG + Exonic
920237636 1:204518992-204519014 ACATTTAACCTGAGACTTGAAGG + Intronic
920455623 1:206098991-206099013 ACCTTTGAGTATAAACTTGCAGG + Intronic
920476276 1:206278722-206278744 ACATTTGTGCAAAAATTTAAAGG + Intronic
920616892 1:207502457-207502479 ACATTTTAGCAGATGCCTGAAGG + Intronic
920670300 1:207998970-207998992 GCATTTGAGCAGAAGTTTGAGGG - Intergenic
920867676 1:209766889-209766911 CCATTTTAGCTGAATCTTGAAGG + Intronic
920938644 1:210459621-210459643 ACATTTGAGCAAAAACTTGAAGG - Intronic
920953934 1:210600032-210600054 TCATTTGAGCTGAAATCTGAAGG - Intronic
921224623 1:213005913-213005935 ACATTTGAACAAATATTTGAAGG - Intronic
921253822 1:213321826-213321848 CCATTTGAGCAAAGACATGAAGG + Intergenic
921300400 1:213746282-213746304 ACATTTGGGCAGAGACTGCAGGG + Intergenic
921515685 1:216088196-216088218 ACATTTGAGCAGAGACCTAAAGG - Intronic
921588948 1:216980968-216980990 ACATTTGAGCTGAGACTTTATGG - Intronic
921672489 1:217941782-217941804 ATATTTGAGCAAAGTCTTGAAGG + Intergenic
921710499 1:218368693-218368715 GCATGTAAGCAGACACTTGAAGG + Intronic
921836224 1:219781719-219781741 ACATTTGAGCTGAGACTTGAAGG - Intronic
921892366 1:220366252-220366274 ACATTTAAGCAGAGGCTTAAAGG + Intergenic
921912707 1:220568290-220568312 AGATTTAAGCAAAGACTTGAGGG + Intronic
922043030 1:221915699-221915721 ACCTTTGAGCAGAGACCTGAAGG - Intergenic
922260113 1:223932765-223932787 ACATTTAAGAATAGACTTGAAGG - Intergenic
922311198 1:224392655-224392677 TCATTTGCCCAGAACCTTGAAGG - Intronic
922437657 1:225622195-225622217 ACATATGAACACAAATTTGAAGG - Intronic
922874335 1:228928133-228928155 ACACTTGAGCAGAAAGCTGGGGG + Intergenic
922964936 1:229681334-229681356 CCATTTGACCACAAACATGAGGG + Intergenic
923024186 1:230191482-230191504 TTATTTGAGCAGAAATTAGAGGG + Intronic
923333375 1:232946306-232946328 GCATCTGAGCAGAGAGTTGAAGG - Intergenic
923346598 1:233059158-233059180 ATACTTGAGCTGAGACTTGAAGG - Intronic
923371294 1:233316706-233316728 AGATTTGAGCAAAGACTTGAGGG - Intergenic
923466852 1:234256053-234256075 AAAAATGAGCAGAAACTAGAGGG - Intronic
923544589 1:234914871-234914893 ACGTGTGAGCTGAGACTTGAAGG + Intergenic
923548860 1:234945449-234945471 ACAGGGGAGGAGAAACTTGAGGG + Intergenic
923772471 1:236949544-236949566 AGCTTGCAGCAGAAACTTGACGG - Intergenic
923806321 1:237261761-237261783 ACTTTTGAGCAAAGACTTTAAGG - Intronic
924214872 1:241810636-241810658 ACATTTGAACAGAGATCTGAAGG - Intergenic
924326347 1:242898096-242898118 ATCTTTGAGCAGAATCTTTAGGG + Intergenic
924341280 1:243035324-243035346 ACATTTAAGAATAGACTTGAAGG - Intergenic
924452906 1:244195344-244195366 ACATTTGAGCAGAGACCTGGCGG - Intergenic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
924726666 1:246677851-246677873 ACATTTCAGAAGAAACTAGAAGG - Intergenic
1063080119 10:2760047-2760069 ACAACTGAGCAAAGACTTGAAGG + Intergenic
1063582271 10:7318868-7318890 ACATTTTAGCAGAGACTTAAAGG + Intronic
1064196347 10:13246978-13247000 AGAATTGAGCAGAATCTAGAAGG - Intergenic
1064300437 10:14118359-14118381 AAATTTCTGCAGAAATTTGATGG + Intronic
1064325195 10:14343816-14343838 ACATTTGAGCAAACACCTGGAGG - Intronic
1064889954 10:20159852-20159874 ATTTTTCAGCAGAAACTCGAAGG - Intronic
1064915864 10:20457592-20457614 ACCTTTGAACAGAAAAGTGATGG - Intergenic
1064931769 10:20636668-20636690 ATATTTTAGCAGAGACATGAAGG + Intergenic
1065065748 10:21962010-21962032 ATATTTGAGCAAAGACCTGAAGG - Intronic
1065295390 10:24269573-24269595 ACACTTTGGCAGAAACATGAAGG + Intronic
1065388211 10:25155264-25155286 ACCTTAGAGCAGAAATATGAAGG - Intergenic
1065417187 10:25501296-25501318 GCATTTAAGCTGAGACTTGAAGG - Intronic
1065614151 10:27503290-27503312 ACATTTGAGCGAAGACCTGAAGG + Intergenic
1065922586 10:30405946-30405968 ACATTTGAACAGAAGCCTGAAGG - Intergenic
1065969155 10:30792195-30792217 ACATTTGAGAAAAGACTTGAAGG - Intergenic
1065977292 10:30853580-30853602 CCATTTGTGCAAAACCTTGAAGG - Intronic
1065982451 10:30913466-30913488 ACATTTAAGCAAAAATCTGATGG - Intronic
1066128995 10:32371927-32371949 AGAGTTGAGCAAAGACTTGAAGG - Intronic
1066197894 10:33118775-33118797 ACAGCTGAGCTGAAACTAGAAGG - Intergenic
1066213375 10:33262372-33262394 ACATTTGAGCGAAGATTTGAAGG - Intronic
1066735192 10:38470110-38470132 ACATTTAAGAATAGACTTGAAGG + Intergenic
1067192210 10:44081251-44081273 ACTTTTGAATAGAGACTTGAAGG + Intergenic
1067406454 10:46028170-46028192 ACCTCTGAGCAGACACCTGAAGG - Intronic
1067724673 10:48761110-48761132 ACATGTAAGCAGAGACCTGAAGG + Intronic
1067964068 10:50889230-50889252 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1067967508 10:50929233-50929255 ATGTTTGAGCAGAGACTTGAGGG - Intergenic
1068134412 10:52937427-52937449 ATATTTGAGCAAACACCTGAAGG + Intergenic
1068205389 10:53844021-53844043 ATATTTGAGCAAAAACTTTAGGG + Intronic
1068945028 10:62721142-62721164 ACATTTGATCAGAGAAATGAAGG - Intergenic
1069278997 10:66629871-66629893 ACTTTTGAGCAGAGATCTGATGG - Intronic
1069309058 10:67010632-67010654 ATATGTGAGCAGAAACTTGCTGG - Intronic
1069333269 10:67318707-67318729 ACATTTGAGCAAAGGCTTGGAGG - Intronic
1069337876 10:67374697-67374719 ACTTTTGAACAGGGACTTGAAGG + Intronic
1069444149 10:68457397-68457419 GCATTTGAGCAGAAGCTTAAAGG - Intronic
1069663997 10:70142961-70142983 GTATCTGAGCAGAAACTTGAAGG - Intronic
1069862521 10:71480522-71480544 GCATTGGAGCTGAGACTTGAGGG + Intronic
1070373822 10:75810031-75810053 ACATTTGAGCTGAGATGTGAGGG + Intronic
1070407017 10:76106066-76106088 ACAAATGACCACAAACTTGATGG - Intronic
1070539362 10:77405181-77405203 ATATTTGAGCAAAGACTTAAGGG - Intronic
1070718038 10:78736755-78736777 ACATTTGTGCTGAATGTTGATGG - Intergenic
1071141071 10:82510064-82510086 ATATTTGAGCTGAGACTTGAAGG - Intronic
1071257643 10:83886724-83886746 ACATTTTAGCTGAGACTTGATGG + Intergenic
1071587707 10:86841513-86841535 ATATTTGAGCAGAGTCTTGATGG + Intronic
1071812875 10:89202393-89202415 ACATTTGAGCTAAATCATGAAGG - Intergenic
1071941002 10:90591860-90591882 ACATTTGAGATGAAAGCTGAAGG + Intergenic
1071953744 10:90734556-90734578 ACATTAGAGCAGAGAACTGAGGG - Intergenic
1072003986 10:91224604-91224626 ACATTTGAACAGAAACCTGAAGG + Intronic
1072044737 10:91643561-91643583 ACATTTGAGCCAGACCTTGAAGG - Intergenic
1072079741 10:92017244-92017266 ACATTTGAGCAAAGATCTGAAGG + Intronic
1072288918 10:93944090-93944112 ACATTTGAGCAGAGACTGCAAGG - Intronic
1072490673 10:95903211-95903233 ATGCTTGAGCAGAAACTTTATGG + Intronic
1072692365 10:97580523-97580545 GCATTTGAGCTGCATCTTGAAGG + Intronic
1072912852 10:99519533-99519555 ACAGATGAGCAGAAACTTCCTGG + Intergenic
1073015666 10:100397188-100397210 AAATTTGAGCAAAGATTTGAGGG + Intergenic
1073182635 10:101594357-101594379 ACATTTGAGCTGGATTTTGAAGG + Intronic
1073247186 10:102099420-102099442 ATATTTCAGCGGAGACTTGAAGG - Intergenic
1073618986 10:105027214-105027236 TCATTTGAGCAGAAACCTGAAGG - Intronic
1073676776 10:105656147-105656169 ACATTAAAGCAGGAAGTTGAAGG + Intergenic
1074143569 10:110697733-110697755 AGACTTGAGCAAAAGCTTGAGGG - Intronic
1074304062 10:112260235-112260257 ACGTTTGAACAAAGACTTGAAGG - Intergenic
1074443722 10:113500709-113500731 GCCTTTGAGCAGAGACCTGAAGG - Intergenic
1074567301 10:114592234-114592256 ACATTTGAGAAGAAACCCAAAGG + Intronic
1074584873 10:114758038-114758060 ACATTTCAGCAGAGACCTGAAGG - Intergenic
1074616315 10:115072378-115072400 ACATTTGAGCAAAGTCTTCAAGG + Intergenic
1074624223 10:115162331-115162353 AGAACTGAGCAAAAACTTGAAGG + Intronic
1074976217 10:118583984-118584006 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1076299855 10:129417127-129417149 ACATTTAAGCAGAAAATAAAGGG - Intergenic
1076503300 10:130953997-130954019 ACATCTGAGAAAGAACTTGAAGG + Intergenic
1076968010 11:108991-109013 ACATTTAAGAATAGACTTGAAGG - Intergenic
1077128827 11:958883-958905 ACATCTGAGCTGAGTCTTGAAGG + Intronic
1077637068 11:3850235-3850257 TCATTTGAGCTGAGACTTGAAGG + Intergenic
1077883989 11:6372343-6372365 ATATTTGAGCAAAGACTTGAAGG - Intergenic
1077901281 11:6491131-6491153 ACATCTGAGCAAGGACTTGAAGG - Intronic
1077996676 11:7458611-7458633 ATATTTGAGCAAACACTTGAAGG + Intronic
1077999393 11:7481397-7481419 ACATCTTAGCTGAGACTTGAAGG - Intergenic
1078078260 11:8181044-8181066 ATATTTGAGCAAAGACTTGAAGG - Intergenic
1078179566 11:8999793-8999815 ACATTTGAGGAGATACTGAAGGG - Intronic
1078251009 11:9616556-9616578 ACATTTGAGCAGAGACATGAAGG + Intergenic
1078451990 11:11447256-11447278 ACATTTGAGCAAAGACCTGGAGG - Intronic
1078536101 11:12175712-12175734 ACATTTGAGCAGAGACCTAAAGG + Intronic
1078653157 11:13214726-13214748 ACATTTGAGCTGGCTCTTGAGGG + Intergenic
1078656737 11:13247532-13247554 ATATTTGAGCTGGATCTTGATGG - Intergenic
1078758882 11:14235843-14235865 ACATTTGAGCAAAGACCTGGAGG + Intronic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079068009 11:17314579-17314601 ACATTTGAGCACAGACTCGGTGG - Intronic
1079087484 11:17457058-17457080 ACATTTGAGCAGAGTCTTGATGG + Intronic
1079252393 11:18796121-18796143 ACAGTGGAGCAAAAACTTGAAGG - Intergenic
1079306392 11:19327233-19327255 ACATCTGAGCTGGAACCTGAAGG - Intergenic
1080255602 11:30287440-30287462 TCATTTGAGAAAAGACTTGAAGG - Intergenic
1080259937 11:30337958-30337980 ATATTTGAGCAGAACCTTAAAGG + Exonic
1080397059 11:31899750-31899772 ACATGTAAGCAAAGACTTGAAGG - Intronic
1080399250 11:31919046-31919068 ACATCTGAGCAAACACCTGAAGG + Intronic
1080423512 11:32135357-32135379 ACACTTGAGCAGAGTCTTGAAGG + Intergenic
1080535213 11:33214933-33214955 ACATGTGAACAAAGACTTGAAGG + Intergenic
1080993502 11:37571315-37571337 ACTTAAGAGCTGAAACTTGATGG + Intergenic
1081009702 11:37794824-37794846 ACTTTTGAGGAGATACTTTAAGG - Intergenic
1081232189 11:40599124-40599146 ACATTTGAGCTGTAACATGAAGG - Intronic
1081250735 11:40830007-40830029 ACAGTTGAGCAGGGTCTTGAGGG + Intronic
1081286069 11:41271507-41271529 ACATCTGAACAAAAAGTTGAAGG - Intronic
1081620176 11:44614746-44614768 ACATTGGAGCAGAGCCCTGAAGG + Intronic
1081737856 11:45416847-45416869 ACATTTGAGCAAAGACATGAAGG - Intergenic
1081928802 11:46853350-46853372 ACATTTGAGCAAAGACTTAAAGG + Intergenic
1082014484 11:47474385-47474407 ACATTTAAGCAGAGAACTGAAGG - Intronic
1082195139 11:49295235-49295257 ACATTTGAATAATAACTTGATGG - Intergenic
1082223713 11:49675192-49675214 GCATTTGAGCTGCATCTTGAAGG - Intergenic
1082262025 11:50083712-50083734 AAAATTGAGCAAAGACTTGAAGG - Intergenic
1082675683 11:56099144-56099166 ACAGGTGAGCAAAGACTTGAAGG - Intergenic
1082677043 11:56117877-56117899 ACAGTTCAGCAAAGACTTGAAGG - Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1082976168 11:59075026-59075048 ATTTTTGAGCAGAAACTTATAGG - Intergenic
1083058563 11:59846586-59846608 ACCTCTGAGCAGAGACATGAAGG - Intergenic
1083180274 11:60980877-60980899 CCATTTGAGCAGAAACCTGGAGG + Intronic
1083185340 11:61014384-61014406 ACATTCTAGGAGAATCTTGATGG - Intronic
1083275023 11:61592042-61592064 GCATCTGAGCAAAGACTTGAGGG + Intergenic
1083432464 11:62621438-62621460 ACATTTGAGCTAAGACCTGAAGG + Intronic
1083455154 11:62773823-62773845 ACATTTGAACTGAAATCTGAAGG + Intronic
1083489432 11:63004527-63004549 ACATTTGAGCAAAGATCTGAAGG - Intronic
1083582753 11:63835599-63835621 ACACTTGAGTAAAATCTTGAAGG - Intergenic
1083614569 11:64019849-64019871 GCATTTGAGCTGAGGCTTGAAGG + Intronic
1083816704 11:65136652-65136674 ACATTTGAGCAAAGACTTAAAGG + Intergenic
1084160945 11:67349794-67349816 GCATTTGAGCAGAGACTTGAAGG - Intronic
1084168006 11:67385702-67385724 CCATTTGAGCAAAGACTTGCAGG - Intronic
1084440960 11:69172955-69172977 ACACTTGGGCAGACACTTGAAGG - Intergenic
1084951902 11:72671092-72671114 ACATTTGAGCCGGACCTTGAAGG - Intronic
1085027453 11:73244885-73244907 GCATTTGGGCAAATACTTGAAGG + Intergenic
1085039088 11:73316529-73316551 ACATTTGAGCAGAAGCCTGGAGG + Intronic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1085080929 11:73633646-73633668 ACATTTGAGCAGAGACAGCAAGG - Intergenic
1085375277 11:76054697-76054719 ACATTTGAACAAAAACCTGAAGG - Intronic
1085432979 11:76471954-76471976 ACATATGAACAGAAACCAGAAGG - Intronic
1085543927 11:77299322-77299344 ACATTTGAGCAAGGAATTGAAGG - Intronic
1085555899 11:77421336-77421358 ATATTTCAGCAGAGACTTGAAGG - Intronic
1085693441 11:78683988-78684010 ACATTTTAGCAGAGCCTGGAGGG - Intronic
1085803592 11:79613881-79613903 ACATTTGAGCAGAAACCTAAAGG - Intergenic
1085821246 11:79795967-79795989 ACATTTGAGTTGGATCTTGATGG - Intergenic
1085933477 11:81114577-81114599 ACATTTAAGCAAAAACCTAAAGG - Intergenic
1086299186 11:85406954-85406976 ACGTTTAAGCAGAAACCTGAAGG + Intronic
1086314459 11:85575692-85575714 ACATTTGAGTAAAGACTTGAGGG - Intronic
1086625342 11:88944070-88944092 GCATTTGAGCTGCATCTTGAAGG + Intronic
1087008019 11:93488145-93488167 ACACTGGACCAGAGACTTGAAGG + Intronic
1087025907 11:93649675-93649697 ACATTTGAGAAGAGACTTTAAGG + Intergenic
1087073457 11:94105130-94105152 ACATTAAAACAGAAATTTGATGG - Intronic
1087144869 11:94801170-94801192 ACATTTGAGTTGGAACTTGAAGG + Intronic
1087256055 11:95955356-95955378 ACATTTGAGCAAAGATTTAAAGG - Intergenic
1087883030 11:103441280-103441302 ACATTTGAGCAAAGACCTGAAGG - Intronic
1088202226 11:107350820-107350842 ACATTTGAGAAGATATGTGAAGG + Intronic
1088242233 11:107784356-107784378 ACATTTGAGATCAACCTTGATGG + Intergenic
1088461148 11:110084500-110084522 ACATTTGAGCAGAAATCCAAAGG + Intergenic
1088622921 11:111705071-111705093 CCAGTGGAGCAGAGACTTGATGG + Exonic
1088810847 11:113391079-113391101 CCATTTGAGTAGAGATTTGAAGG + Intronic
1088832749 11:113551326-113551348 ACATTTGAGAAGAGACCTGAAGG - Intergenic
1089080037 11:115767974-115767996 ATATTTGACCAGGATCTTGAAGG - Intergenic
1089182812 11:116594716-116594738 ACATTTGAGCAGGTCCTTTAAGG - Intergenic
1089312017 11:117564610-117564632 AGGTTTGAGCAGAGCCTTGAGGG - Intronic
1089367576 11:117930716-117930738 ATATTTGAGCAAAAACTGAAAGG + Intergenic
1089410978 11:118242699-118242721 ATATTTGAGCTGGAATTTGAAGG - Intronic
1089417384 11:118303490-118303512 ACATCTAAGCTGAAATTTGATGG - Intergenic
1089513049 11:119012810-119012832 ACATTTGAGCTAACAGTTGAAGG - Intronic
1089783533 11:120891823-120891845 ACCTTTGAGCTGAAGCCTGAGGG + Intronic
1089785005 11:120901427-120901449 ACATCTGAGCAGAGCCTTGAAGG - Intronic
1090218646 11:124995216-124995238 ACATTTAAGCTGAAACCCGAAGG - Intronic
1090223144 11:125048590-125048612 ATATTTGAGCAAAGATTTGAAGG - Intergenic
1090231108 11:125104404-125104426 ACATTTAAGCAGAAATCAGAAGG - Intronic
1090339385 11:126003003-126003025 ACATCGGAGCAGAGACATGAAGG - Intronic
1090826262 11:130388725-130388747 ACATCTGAGCTGACTCTTGAAGG + Intergenic
1090908655 11:131098850-131098872 ACATTTCAGCAGAGGCTTGAAGG + Intergenic
1090935425 11:131337461-131337483 ACATTTAAGCAAAACCTTGAAGG - Intergenic
1091171525 11:133523852-133523874 ACAATTGAACAGAGATTTGAAGG - Intronic
1091483594 12:860778-860800 CCATTTTTGCAGAAACTCGAAGG - Intronic
1091870099 12:3882455-3882477 ACATTTAAGGAAAAACTTGGAGG + Intergenic
1092380214 12:7990001-7990023 ACATTTAAGCTGGACCTTGAAGG - Intergenic
1092655568 12:10680851-10680873 ACATTTGATCAGATACCTGAAGG - Intergenic
1092736107 12:11584613-11584635 ACATTTCAGCTGAGCCTTGAAGG - Intergenic
1093410400 12:18858338-18858360 ATATTTGAGCAAAGACTTGAAGG - Intergenic
1093547364 12:20365000-20365022 ACATTTGAGGTTAGACTTGATGG + Intergenic
1093647294 12:21601563-21601585 ATGTTTGAGCTGACACTTGAAGG - Intronic
1093695555 12:22156465-22156487 AGACTTAAGCAGAAACTTCAAGG + Intronic
1093738062 12:22646983-22647005 ACATTTGAACTGAACTTTGAAGG + Intronic
1093776475 12:23081043-23081065 AGACTTGAGCAGACACTTCAGGG + Intergenic
1093779855 12:23122629-23122651 ACATTTGAGGAATAACATGAAGG + Intergenic
1093803897 12:23409080-23409102 GCATTTGAGCAAAGACTTAAAGG + Intergenic
1093829467 12:23737850-23737872 ACATTTGAGCAGAAACCTGTAGG - Intronic
1094068773 12:26389599-26389621 AGATTTCAGCAAAAATTTGAAGG - Intronic
1094120535 12:26969471-26969493 ACATTCCAGCTGAAACTTGGAGG - Intergenic
1094246909 12:28308668-28308690 ATACTTGAACAGAGACTTGAAGG - Intronic
1094326284 12:29243013-29243035 ACATTTTAGCAGAGACTCAAAGG + Intronic
1094360437 12:29624656-29624678 ACATTAGAGCAGAGACATGAAGG - Intronic
1094522902 12:31211590-31211612 ACATTTGGGCAAAGTCTTGACGG - Intergenic
1094564541 12:31588230-31588252 ACATTTGAACAGAGCCTTGAAGG - Intronic
1095129721 12:38525587-38525609 ATATTTGAGAAAAATCTTGAAGG + Intergenic
1095155783 12:38852001-38852023 ACATTTAAGCAGAGGCTTAAAGG - Intronic
1095475142 12:42579282-42579304 ACTTTTGAGCAGAGACCTGAAGG + Intronic
1095486240 12:42687609-42687631 ACATCTGAGCTAGAACTTGAAGG + Intergenic
1095519610 12:43047313-43047335 ACATATGAACTGAAACTGGAAGG + Intergenic
1095558312 12:43535003-43535025 TTATTTGAGCTGAGACTTGAAGG - Intronic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1095743516 12:45632704-45632726 ACCTGTGAGCAAAGACTTGAAGG + Intergenic
1096380257 12:51151069-51151091 ACATGTGAGCAGAAACCTAAAGG + Intronic
1096485081 12:51974773-51974795 ACATTTGAGTTGAATTTTGAAGG + Intronic
1096558291 12:52417691-52417713 ACACTGGACAAGAAACTTGAAGG - Intergenic
1097969948 12:65622951-65622973 ACATTTGAGCAGAGACTTGAAGG + Intergenic
1097976936 12:65696628-65696650 CTATTTGAACTGAAACTTGAAGG + Intergenic
1098087104 12:66857838-66857860 ACACTTGAGCTGAGTCTTGAAGG + Intergenic
1098236569 12:68423747-68423769 ACATTCAAGCAGACACTTAAAGG + Intergenic
1098270005 12:68760976-68760998 ACATTTGAGTAAAGACCTGAAGG + Intronic
1098523348 12:71458947-71458969 ACATTTAATCTGAAACTTGGAGG + Intronic
1098794472 12:74871348-74871370 ACATATCAGCAGATACTTAATGG + Intergenic
1098910942 12:76207774-76207796 ACATTTGAGCAAATACATGGTGG - Intergenic
1098978669 12:76931300-76931322 ACCTTTGATGAGCAACTTGAAGG - Intergenic
1098988785 12:77042037-77042059 ACATTTGAGCCAGATCTTGAAGG + Intronic
1099201007 12:79676857-79676879 AGATTTGAACTGAATCTTGAAGG - Intronic
1099207342 12:79743738-79743760 ATATTTGACCAGGAACCTGAGGG - Intergenic
1099338498 12:81396395-81396417 ACATTTGAACAAAGACTGGATGG + Intronic
1099456025 12:82864001-82864023 ACATTTGAGTAGAACCTTGCAGG + Intronic
1099677020 12:85773853-85773875 ACATTTGTGCAGATATCTGAAGG - Intergenic
1099803062 12:87481471-87481493 ACTTTTGAGGAAATACTTGAAGG - Intergenic
1099891155 12:88589890-88589912 ACATTCTAGTAGCAACTTGAGGG + Intergenic
1100056655 12:90519756-90519778 ACATTTGAGTGGAGACTTGAAGG - Intergenic
1100275084 12:93064384-93064406 ATGTTTGAGAAAAAACTTGAGGG - Intergenic
1100317758 12:93461165-93461187 GAATTTAAGCAGAAACGTGAAGG - Intergenic
1100426331 12:94490427-94490449 ATATTTGAGCTGAAACCTGAAGG - Intergenic
1100650684 12:96585443-96585465 AGATTTAAGCAGAGACTTGAAGG - Intronic
1100650822 12:96586498-96586520 AGATTTAAGTAGAGACTTGAAGG + Intronic
1100684655 12:96974106-96974128 ACATTTGAGGTGAGACTTGAAGG + Intergenic
1100702283 12:97161329-97161351 ATATTTGAGCAGAGACTAGAGGG + Intergenic
1101004216 12:100385777-100385799 ACATATTACCACAAACTTGATGG + Intronic
1101072291 12:101088289-101088311 ACATTTGAACAAAGACTGGAAGG - Intronic
1101108510 12:101462760-101462782 GCATTTGGGCAAAGACTTGAAGG - Intergenic
1101221524 12:102646330-102646352 GTATTTGAGCTGAGACTTGAAGG + Intergenic
1101241932 12:102847780-102847802 ATATTTGAGCACAGACTTGAAGG + Intronic
1101260776 12:103027405-103027427 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1101688675 12:107052645-107052667 ACATCTGTGCAGAAACCTGAAGG + Intronic
1101798799 12:108002532-108002554 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1102227219 12:111237366-111237388 ACATTTGAGTGGAGTCTTGAAGG - Intronic
1102277462 12:111593956-111593978 ACATTTGAGCAAAGATTTGAAGG - Intronic
1102370221 12:112376763-112376785 GCTTTTGAGCAGAGACCTGAAGG - Intronic
1102422815 12:112817407-112817429 ACATTTGGGCTGGACCTTGAAGG - Intronic
1102470763 12:113158667-113158689 ACATTTGAACAGGGCCTTGAAGG - Exonic
1102550801 12:113690759-113690781 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1102553768 12:113712180-113712202 ACATTTGAGCAAAGACTTGGAGG - Intergenic
1102565227 12:113792880-113792902 ACATTTCAGCCAAGACTTGAAGG - Intergenic
1102588983 12:113943095-113943117 ACACTTAAGCAGAAACTGAATGG - Intronic
1102625834 12:114234882-114234904 ACATTTGACCAGAGTCCTGAAGG + Intergenic
1102748011 12:115267221-115267243 GCATTTGAGCAGCAACCTGGAGG + Intergenic
1102773728 12:115500997-115501019 TCATTTGAGTAGAGACTTAAAGG + Intergenic
1102803907 12:115762621-115762643 ACATTTGAGCTGAACACTGAAGG + Intergenic
1102811288 12:115826231-115826253 ACATTTGAGCAGAGACAGGTGGG - Intergenic
1102811350 12:115826938-115826960 ACATTTGAGCAGAGACATGTGGG - Intergenic
1102956886 12:117064762-117064784 ACATTTGAGCAGAGACCTGAAGG + Intronic
1103070329 12:117935924-117935946 ACATTTGAGCAAAGACTTAAAGG - Intronic
1103217122 12:119210434-119210456 ATATTTGAGCAAATATTTGATGG - Intronic
1103364661 12:120372828-120372850 ACGTTTTAGCAAAGACTTGAAGG + Intergenic
1103398066 12:120623128-120623150 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1103487585 12:121293752-121293774 TCATTTGTGCAGAGCCTTGAAGG - Intronic
1103916617 12:124379087-124379109 ACATTTGAGCCAAGATTTGACGG + Intronic
1104283049 12:127395920-127395942 ATATTTGAGCTGAGACCTGAAGG + Intergenic
1105390306 13:19970924-19970946 ACATTTAAGCAGAGAATAGACGG + Intronic
1105411092 13:20172305-20172327 ACATTTCAGCTGAGGCTTGAAGG + Intergenic
1105550832 13:21394313-21394335 GGATTTAAGCAAAAACTTGAAGG - Intronic
1105881682 13:24611640-24611662 ACATCTCAGCTGAATCTTGAAGG - Intergenic
1106090718 13:26590983-26591005 ATATTTGGGCAGAGATTTGAAGG + Intronic
1106318150 13:28613442-28613464 ACATTTGATTAGAGATTTGAAGG - Intergenic
1106775279 13:33002708-33002730 GCATTTCAGCAGAGACCTGAAGG - Intergenic
1106816106 13:33408905-33408927 ACATTTGAGCAGAGATGTGAAGG - Intergenic
1106853294 13:33818463-33818485 GCATCTGAGCCGAGACTTGAAGG + Intronic
1107038910 13:35928436-35928458 ACATTTGAGCAAAGACTTGAGGG - Intronic
1107206863 13:37801818-37801840 ACATTTGAGCTGGATTTTGAAGG + Intronic
1107495319 13:40920577-40920599 ATATTTGAGCAGAGACCTGAAGG - Intergenic
1107646141 13:42496115-42496137 ACTTTTGAGCAAAGACTGGAAGG - Intergenic
1107666563 13:42696883-42696905 GCATTTGAGCTTAGACTTGAAGG + Intergenic
1107741153 13:43452013-43452035 ACAGTTGAGTAGAGACCTGAAGG + Intronic
1107798432 13:44079550-44079572 ACATTTGAGCAGAGACCCGAGGG + Intergenic
1107850686 13:44570027-44570049 ACATCTGAGCTGAGTCTTGAAGG + Intronic
1107933413 13:45325111-45325133 ACATCTGAACAGAAACTTAAAGG + Intergenic
1108027957 13:46198564-46198586 ACATTTGAACAAAAACATGAGGG + Intronic
1108153285 13:47558664-47558686 CTATTTGAGCAGAGATTTGAAGG - Intergenic
1108195595 13:47991422-47991444 AGATTTAAAGAGAAACTTGAAGG - Intronic
1108281271 13:48864647-48864669 ATATTTAAACAAAAACTTGAAGG + Intergenic
1108305593 13:49128883-49128905 AAGCTTAAGCAGAAACTTGAAGG - Intronic
1108368645 13:49744914-49744936 ACATTTAAGCTGAAACCTGAAGG - Intronic
1108439673 13:50438184-50438206 ACATTTGAACAAAAACTTAAAGG + Intronic
1108483504 13:50900692-50900714 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1108963854 13:56272029-56272051 AAATACTAGCAGAAACTTGAAGG + Intergenic
1109188816 13:59301171-59301193 ACATTTGAGCAGAGATTTGAAGG + Intergenic
1109191343 13:59327671-59327693 GCATTTGAACAAAAACTTGAAGG + Intergenic
1109245756 13:59953140-59953162 ACATTTGAGTTAAGACTTGAAGG + Intronic
1109492652 13:63122979-63123001 ACATTTGAGTAAAGACCTGAAGG + Intergenic
1109890765 13:68609948-68609970 GCATTTTATCAGAATCTTGACGG - Intergenic
1109988844 13:70026949-70026971 ACTTTTCAGCATAAAATTGAAGG - Intronic
1110331189 13:74275058-74275080 ACATTTGAGCAAAGATCTGAAGG + Intergenic
1110701320 13:78552150-78552172 ACATTTGAGCAAAGACCTGAAGG + Intergenic
1111161749 13:84403680-84403702 ACATTTGAACAGAAAGTGTAAGG - Intergenic
1111548087 13:89770366-89770388 ACATTTGAACAGAAATGTAAAGG - Intergenic
1111716279 13:91883477-91883499 GCATTTGAGGAGAGACTTGAAGG + Intronic
1111758726 13:92433916-92433938 ACATTTGAAGAGAAAGGTGAAGG + Intronic
1111894087 13:94119420-94119442 ACCTTTGAGCAGACAACTGAAGG + Intronic
1111931675 13:94519068-94519090 ACATTTGTGCTGGAACTTAAAGG - Intergenic
1111973443 13:94940905-94940927 AGATTTGAGTAAAGACTTGAAGG + Intergenic
1112249217 13:97763711-97763733 ATATTTGAACAGAAATTTGAGGG + Intergenic
1112423051 13:99271283-99271305 ATATTTGAGCAAAGACCTGAAGG + Intronic
1112524533 13:100131975-100131997 ACATTTTGGCAGAGACCTGAAGG + Intronic
1112699342 13:101987406-101987428 ACATTTGAGCAGAGACTTAAAGG - Intronic
1112843603 13:103610227-103610249 ACAATTGAGTAGAAATCTGAAGG - Intergenic
1113326188 13:109283572-109283594 GCATCTGAGCTGAAACTGGAAGG + Intergenic
1113383100 13:109821374-109821396 ACATGTGATCAGAGCCTTGAAGG - Intergenic
1114359285 14:21952768-21952790 ACATTTGAGCTGAGACCTGAAGG - Intergenic
1114361084 14:21973618-21973640 AAATTTGAGCAGAATAATGAAGG - Intergenic
1114576962 14:23724405-23724427 ACATTTTAGCAAAGACTTGAAGG + Intergenic
1114678524 14:24462177-24462199 ACATTTGATTAGAGACCTGAAGG - Intergenic
1114767201 14:25386977-25386999 ACATTTGAGCAAAGGCTTGAAGG + Intergenic
1115520300 14:34226986-34227008 ACATTTGAGCAGAGTCTTGAAGG - Intronic
1115718824 14:36137135-36137157 ACATTTGAGCAGAAACACAAAGG + Intergenic
1115954128 14:38758715-38758737 ACATTTGAGTAGAGACTTGAAGG + Intergenic
1116019860 14:39447246-39447268 GCGTTTGAGTAAAAACTTGAAGG + Intergenic
1116020782 14:39457689-39457711 ATGTTTGAGCAGAAATCTGAAGG + Intergenic
1116090560 14:40299547-40299569 GTATTTGAGCAAATACTTGAAGG + Intergenic
1116434320 14:44879173-44879195 ACTTTTCAGTAGAAACTTTATGG + Intergenic
1116578093 14:46601731-46601753 ACATTTGAGCAAAAACTTGAAGG + Intergenic
1116593948 14:46815834-46815856 AAGTCTGAGCAGAGACTTGAAGG - Intergenic
1116600168 14:46911197-46911219 TAATTTGAGTAGAAATTTGAAGG - Intronic
1116801622 14:49450147-49450169 ACATTTGATCAGAGCCTTGGAGG + Intergenic
1117238739 14:53806198-53806220 ACTTCTGAGTAGGAACTTGATGG + Intergenic
1117314143 14:54557555-54557577 GCATTTGAGCTAAAACCTGAGGG + Intergenic
1117316122 14:54572313-54572335 ACATTTGAGCTGAGTCCTGAGGG + Intronic
1117317692 14:54589852-54589874 ACATATAAGCAGAGACCTGAAGG - Intronic
1117428200 14:55623057-55623079 ACATTTAAGTGGAGACTTGAAGG - Intronic
1117830875 14:59748446-59748468 ACATTTGAGCAAAGACTTGGGGG - Intronic
1117915923 14:60677693-60677715 TCAGTTGATCAGAAACTAGAGGG - Intergenic
1118113472 14:62749087-62749109 ACATTTTAACAGCAGCTTGAGGG - Intronic
1118178265 14:63464370-63464392 ACATTTGAGCAAATACTTGAAGG + Intronic
1118441526 14:65816411-65816433 ACATTTGAACAGACATTGGAAGG - Intergenic
1118512361 14:66489440-66489462 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1118518808 14:66557721-66557743 ACATTTAAGCAGAATCCAGAGGG - Intronic
1118707319 14:68492162-68492184 ATATTTTAGCAAAAACTTAAAGG - Intronic
1118884443 14:69854603-69854625 ATATTTGAGCAGAGGCTTAAAGG - Intronic
1119535015 14:75395903-75395925 ACATTTAAGCTGAGACATGAAGG + Intergenic
1119592383 14:75901999-75902021 ACATTTGAACAAAGCCTTGAAGG + Intronic
1119631465 14:76235928-76235950 ACATTGGAGAAGAAACTGCAGGG - Intronic
1119770422 14:77217317-77217339 ACATCTGAGCAAGGACTTGAGGG - Intronic
1119811179 14:77520958-77520980 ACATCTGAGCAAAGATTTGAAGG - Intronic
1119827114 14:77666441-77666463 ATATTTGAGCAAAGACTGGAAGG + Intergenic
1119892796 14:78195588-78195610 ACATCTGAGCTAAGACTTGAGGG + Intergenic
1120146997 14:80989609-80989631 GCATTTGATCTGAGACTTGAAGG - Intronic
1120317044 14:82907503-82907525 ACATTTGAGGAAAGACTTCAAGG - Intergenic
1120435500 14:84476404-84476426 AAATTTCAGCAGAAAATTGTAGG - Intergenic
1120617602 14:86727142-86727164 GCCTTTGAGCAGAGACTTGAAGG - Intergenic
1120734221 14:88035453-88035475 ACATTTGTCCTGAATCTTGAAGG + Intergenic
1121383934 14:93499822-93499844 ACATTTAAGCTGATACCTGAAGG + Intronic
1121658003 14:95612362-95612384 AGATTTAAGCACAAACTTGAAGG - Intergenic
1121728440 14:96169855-96169877 GCATTTGAGCTGAGACTTAAAGG - Intergenic
1122239493 14:100352859-100352881 TCATTTGGGATGAAACTTGAAGG + Intronic
1122496559 14:102160435-102160457 ACATTTGAGCAGAGATGGGAAGG + Intronic
1123509375 15:20981151-20981173 ATATTTGAGAAAAGACTTGAAGG + Intergenic
1123566597 15:21554891-21554913 ATATTTGAGAAAAGACTTGAAGG + Intergenic
1123602858 15:21992184-21992206 ATATTTGAGAAAAGACTTGAAGG + Intergenic
1123687608 15:22810213-22810235 ACATTTGACCTGAGACTTGCCGG - Intronic
1123804638 15:23858803-23858825 AGCTTTGAGCAAAAACTTGAAGG + Intergenic
1124080728 15:26492408-26492430 ACATTTGAGCAAAGACTTGAGGG - Intergenic
1124098870 15:26674699-26674721 GACTTTGAGCAGAAACCTGAGGG + Intronic
1124382543 15:29178630-29178652 AAATCTTAGCAGAAACTTAAGGG - Intronic
1124863320 15:33464261-33464283 ACATTTGAGCAGACACCTAAAGG + Intronic
1125383534 15:39112888-39112910 ACATTTCAGCTGAAACTTGTAGG + Intergenic
1125461042 15:39907071-39907093 ACATTTGAGCTGCAATTTAAAGG + Intronic
1125549375 15:40533832-40533854 ACATTTGAGCAAAGACTTGGAGG + Intronic
1125778011 15:42235682-42235704 ACATTTAAGCAGAGACTTCAAGG - Intronic
1126062396 15:44795517-44795539 ACATTTGAGCAGAGAGCTGAAGG + Intergenic
1126340718 15:47638011-47638033 AGATTTGACCAAAAACATGAAGG + Intronic
1126491967 15:49247086-49247108 ACATTTGAACAGAGACCTTAGGG + Intronic
1126700437 15:51362032-51362054 ACATTTGAGCAGAGACTTGAAGG + Intronic
1126736098 15:51733566-51733588 ATATTTAAGCAAAGACTTGAAGG + Intronic
1127512442 15:59656310-59656332 TTATTTGAGCAAAGACTTGAAGG - Intronic
1127558376 15:60110474-60110496 ACATTTGAATAAAGACTTGAAGG - Intergenic
1127626837 15:60788126-60788148 ACATTTGAGCCGAGACAGGAAGG + Intronic
1127701767 15:61508199-61508221 ACATTTGAGCTGAAATCTGAAGG - Intergenic
1127897658 15:63316561-63316583 ACATTTGAGCAGGATCTTGAAGG - Intergenic
1127938403 15:63666884-63666906 ACATGAGAGCTGAAACATGAAGG - Intronic
1128105567 15:65042189-65042211 ACATTTAAGCTGAGGCTTGAAGG + Intergenic
1128206622 15:65858423-65858445 ACATTTGAGCAAAGATTTAAAGG - Intronic
1128271842 15:66317069-66317091 ACATTTGAACAGTGACTTGAGGG - Intronic
1128369645 15:67031138-67031160 ACATCTAAGCTGAAACTTGAAGG + Intergenic
1128402074 15:67293742-67293764 ACATGTGAGCACAAATTTGATGG + Intronic
1128451519 15:67808473-67808495 CCATTTGAGCTGAGACCTGAAGG - Intergenic
1128793342 15:70448814-70448836 ACATTTGAGCAGGGTCCTGAAGG - Intergenic
1128846469 15:70901534-70901556 ACATTTGAGCAAAGACCTGAAGG - Intronic
1128932617 15:71718803-71718825 GCATTTGAGCAGAGATTTGCAGG - Intronic
1129060216 15:72854996-72855018 ACATTTGAGAAAAGACTTGAAGG - Intergenic
1129481365 15:75829206-75829228 ACATTTAAGCTGAGACTTGAAGG + Intergenic
1129508436 15:76102431-76102453 ACATTTGTGCAAAGACCTGAAGG + Intronic
1129557660 15:76529606-76529628 ACATTTGAGTAAAGACCTGAAGG + Intronic
1129569419 15:76664040-76664062 ACATTTGATCAAAGACCTGAAGG + Intronic
1129667191 15:77585948-77585970 ACGTTTGAGCAGAAACCTGAAGG + Intergenic
1129751768 15:78070283-78070305 ACATTTGAGCTGAGACTCAAAGG - Intronic
1129974714 15:79812669-79812691 ACATTTGAGCTCAGACCTGAAGG + Intergenic
1130007026 15:80109441-80109463 ACATTTGAGCAGAGACCTGAAGG + Intronic
1130099463 15:80881472-80881494 ACATTTGAGCTGAGAAATGAAGG + Intronic
1130123093 15:81069224-81069246 ACATTTGCGCAGAGACTGGAAGG + Intronic
1130159748 15:81386644-81386666 ACATTTGAGAAGAGACTTGAAGG - Intergenic
1130421558 15:83752901-83752923 TCAATTGAGCTGAATCTTGATGG - Intronic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1202974958 15_KI270727v1_random:281986-282008 ATATTTGAGAAAAGACTTGAAGG + Intergenic
1133306711 16:4814304-4814326 ACATTTCAGCACAGACTTCAAGG + Intronic
1133482365 16:6183612-6183634 ACATTTGTGCAGAAACATGGAGG + Intronic
1133717105 16:8460315-8460337 ACATCTGAGCAGAGACTTGACGG + Intergenic
1133853204 16:9525313-9525335 ACATTTGCACAGCAACCTGAGGG - Intergenic
1133857149 16:9560331-9560353 ACATTTGAGCAGAGACCTGGGGG + Intergenic
1133911284 16:10068821-10068843 ACATTGAAGCAGAGACCTGAAGG + Intronic
1134084346 16:11346125-11346147 ACATTTGAGCTGAGACGTTAAGG - Intronic
1134204325 16:12224559-12224581 ACATTTGATCAGAGGGTTGAAGG + Intronic
1134271531 16:12737247-12737269 ACATTTGAGCAACAACTTGAAGG + Intronic
1134309731 16:13064930-13064952 ACATTTGAGCTGAGACCTGATGG + Intronic
1134511833 16:14854822-14854844 ACATTTGAGCAACAACCTGAAGG + Intronic
1134672327 16:16065001-16065023 ACACTTGAGGAAAGACTTGATGG + Intronic
1134699476 16:16253321-16253343 ACATTTGAGCAACAACCTGAAGG + Intronic
1134972353 16:18541350-18541372 ACATTTGATCAACAACCTGAAGG - Intronic
1135074300 16:19380240-19380262 ACATTTGAGCAGAGAACTGAAGG + Intergenic
1135142696 16:19935344-19935366 ACATTTGAGCAAAACTTTGAAGG + Intergenic
1135166040 16:20140004-20140026 CCATTTCAGCAGCAACCTGAAGG - Intergenic
1135204383 16:20470468-20470490 ACATATGATAGGAAACTTGAAGG + Intronic
1135214613 16:20554514-20554536 ACATATGATAGGAAACTTGAAGG - Intronic
1135429147 16:22367373-22367395 ACCTTTTAGCTGAAGCTTGAAGG + Intronic
1135532162 16:23264108-23264130 ACATTTGAGCTGAATCTTGAAGG + Intergenic
1135588301 16:23687993-23688015 ACACTGGAGCAGACACTTGAAGG - Intronic
1135985263 16:27179304-27179326 ACATTTGAGCCGAAACCTGAAGG + Intergenic
1136050986 16:27649855-27649877 ACATTTCAGTTGAAACCTGATGG + Intronic
1136098598 16:27976805-27976827 ACATTTGAGCTGGATCTTGAAGG - Intronic
1136341202 16:29644696-29644718 ACATCTGAGGGGAGACTTGAGGG - Intergenic
1136345711 16:29674389-29674411 ACAGTTGAGCTGAATCTTAATGG - Intronic
1137480034 16:48844683-48844705 CCATTTGAGCAGAGTCCTGAGGG - Intergenic
1137625505 16:49905469-49905491 ACATTTGAGCAAAGATTTGAAGG - Intergenic
1137651607 16:50125241-50125263 ACATTTGAGCAGAGACCTGAAGG + Intergenic
1137970409 16:52979281-52979303 CCATTTGAGCAGACAGCTGAAGG + Intergenic
1137978356 16:53049627-53049649 ACATTTGAGCTGGACCTAGAAGG + Intergenic
1138060205 16:53882444-53882466 TCCTTTGAGCAGAGAATTGAAGG + Intronic
1138235722 16:55380639-55380661 ACATGTGAGCAGAGACTTGGAGG + Intergenic
1138399525 16:56734243-56734265 ACCTTTGAGCAGAGATTTGAAGG + Intronic
1138435172 16:56994644-56994666 ACATTTGAGAGAGAACTTGAAGG + Intronic
1138459959 16:57142303-57142325 ACATGTGAGCTGAAACTTGGAGG + Intronic
1138479188 16:57290514-57290536 ACATTTTAGCAGAGACCTGGAGG + Intergenic
1138998837 16:62484126-62484148 ACATTTTAGTTGAATCTTGAAGG - Intergenic
1139049591 16:63107481-63107503 ACATTTGAACAGATACTGGGAGG + Intergenic
1139332952 16:66207996-66208018 ACTCATGAGCCGAAACTTGAAGG - Intergenic
1139690406 16:68638153-68638175 ACATCTGAGCAGAGACCTGAAGG + Intronic
1139837444 16:69850573-69850595 ACATTTGAGCAGTATTTTGAAGG + Intronic
1140002701 16:71040890-71040912 ACATTTGAGTGGAGACTTGAAGG - Intronic
1140023176 16:71259200-71259222 ACATTTGAACAAACACTTGGAGG + Intergenic
1140025632 16:71288260-71288282 ACATTTGAGCAAATATTGGAAGG - Intronic
1140130592 16:72157408-72157430 ACGTTTGAACCGAAACTTGAAGG + Intronic
1140319001 16:73929519-73929541 AGATATAAGCAGAAACTTTATGG - Intergenic
1140674776 16:77317039-77317061 CCATGTGAGGTGAAACTTGAAGG - Intronic
1140850602 16:78931728-78931750 ACACTTGGGCAGAAGTTTGAAGG + Intronic
1140988890 16:80188806-80188828 ACATCTGAGCAGAGGCCTGAAGG - Intergenic
1141178146 16:81734256-81734278 ACATTTGAGCAAAAACCTGAGGG + Intergenic
1141187012 16:81795326-81795348 ATGTTTGAGCTGAGACTTGAAGG + Intronic
1141661044 16:85441682-85441704 ACATTTGAGCTGGGTCTTGAGGG + Intergenic
1142419140 16:89959808-89959830 ACTTTTAAGCAAAAACTTGAAGG + Intronic
1142452668 16:90190154-90190176 ACATTTAAGAATAGACTTGAAGG + Intergenic
1142957866 17:3533381-3533403 ACATTTGAGCAAGGACTTGAAGG - Intronic
1143502038 17:7344933-7344955 ACTTTTGAACAAAGACTTGAAGG + Intronic
1143746089 17:8995282-8995304 ACATTTAAGTTGAAACATGAGGG - Intergenic
1143752409 17:9038116-9038138 ATATTTGACCAAAGACTTGAAGG - Intronic
1143927923 17:10389460-10389482 ACACTTGAGCAGTGACCTGAAGG - Intergenic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1144411468 17:15006160-15006182 ACGTCTGAGCAAAGACTTGAAGG + Intergenic
1144602765 17:16633026-16633048 ACATTTAAGCCGAGACCTGAAGG - Intronic
1145039938 17:19570340-19570362 GCATTTGGGCAGAAACTCAAAGG + Intronic
1145262691 17:21364296-21364318 ACATTTGAACAGAGACCTGAGGG + Intergenic
1145320305 17:21763310-21763332 AAATTTGAACAGAGACTGGATGG + Intergenic
1145890164 17:28408467-28408489 ACATTTTAGTGGAGACTTGAAGG - Intergenic
1146009533 17:29182087-29182109 ACATTTGAGCGGAACCTTGCAGG + Intergenic
1146095075 17:29922062-29922084 ACATTTAAGCTGAGACCTGAAGG + Intronic
1146108517 17:30065003-30065025 ACAGATAAGCAAAAACTTGAGGG + Intronic
1146265796 17:31451752-31451774 ACATTTGTGCTGAAACCTGAAGG - Intronic
1146416003 17:32633800-32633822 ACATTTAAGCAAAGACTTGAAGG - Intronic
1146468168 17:33103696-33103718 ACACCTGAGCAGAAGTTTGAGGG - Intronic
1146543292 17:33716576-33716598 GCATTTGAGCTGGATCTTGAAGG - Intronic
1146636151 17:34506835-34506857 AGATTTGAGCAGAGACCTGAAGG + Intergenic
1146636754 17:34512192-34512214 ACATTTGAGCTGAACCTTAAAGG + Intergenic
1146944799 17:36866279-36866301 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1147056131 17:37836524-37836546 ACATGTGAGCAGAGACTTGAAGG - Intergenic
1147142653 17:38468074-38468096 ACATTTGGGCTAAGACTTGAAGG + Intronic
1147353324 17:39868993-39869015 ACATTTGAGCTGAGCCCTGAAGG - Intronic
1149100459 17:52900413-52900435 GCATTTGAGCTGAAACCTAAAGG + Intergenic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1149783546 17:59417118-59417140 ACATTTGAGCAGAGACCTGGTGG - Intergenic
1150054182 17:61996631-61996653 ACATTTAAGCAAAGACTTGAAGG - Intronic
1151181512 17:72332402-72332424 GCATTTGAGCTGAGCCTTGAAGG + Intergenic
1151194984 17:72424921-72424943 ACATTTGAGCACAGACTTGTAGG - Intergenic
1151325146 17:73375177-73375199 ATATTTGAGCAAAAACCTGAAGG - Intronic
1151663750 17:75533871-75533893 ACATTTGAGCAAAGCTTTGAAGG + Intronic
1152144463 17:78559947-78559969 AGATGTGAGCAGAGACTTGTGGG - Intronic
1152462524 17:80449088-80449110 ACAAATGAGCATCAACTTGATGG - Intergenic
1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG + Intronic
1153171461 18:2320757-2320779 ACATTTCAGCAGGAACATGCAGG + Intergenic
1153256683 18:3178669-3178691 GCATTTGATCTGAATCTTGAAGG - Intronic
1154007236 18:10542344-10542366 AAATTTGTGCAGGAACATGAAGG + Intronic
1155398471 18:25412783-25412805 AGATTTGAGCAGGGACTTGAAGG + Intergenic
1155678083 18:28454733-28454755 ACATTTGAGATGGATCTTGAAGG - Intergenic
1156019608 18:32584940-32584962 ATATGTGAGCAGAAACAAGAAGG + Intergenic
1156177622 18:34565444-34565466 ACAAATTAACAGAAACTTGATGG + Intronic
1156483341 18:37449712-37449734 ACATTTGAAAAGAAACTGGAAGG + Intronic
1156619449 18:38831970-38831992 ACATTCTATCAGAGACTTGATGG - Intergenic
1157064599 18:44333218-44333240 ACCTTTGGGCAGAACCTTGTGGG + Intergenic
1157384988 18:47252946-47252968 TCAATTGAACAGAAACGTGAGGG + Intergenic
1157673269 18:49548873-49548895 ACATTTGGGCAAAGACCTGAAGG + Intergenic
1157702270 18:49769314-49769336 ACATTTGAGCAAATGCTTGAAGG - Intergenic
1158114837 18:53983682-53983704 ACATTTTAGCAAAGATTTGAAGG - Intergenic
1158660088 18:59379301-59379323 ACATTGGAGCTGAAGCTTGAGGG + Intergenic
1158756178 18:60328267-60328289 ACAAATGATCATAAACTTGATGG + Intergenic
1158758742 18:60358370-60358392 ACATCTGAGCAAAAACTTGAAGG + Intergenic
1158856811 18:61550874-61550896 ACCTTTGAGCAGAGAGCTGAAGG + Intronic
1158888069 18:61847875-61847897 ATATTTGAGCTCAGACTTGAAGG - Intronic
1158984236 18:62797566-62797588 TGACTTGAGCAGAGACTTGAAGG + Intronic
1159030740 18:63228347-63228369 ACACTTGAGCAGAGGCCTGAAGG - Intronic
1159095942 18:63901835-63901857 CCATTTGAGAAGAAACTAAATGG + Exonic
1159239955 18:65729533-65729555 ACATTTGAATAGAGACTTAAAGG + Intergenic
1159891928 18:73961254-73961276 ACTTTTGAGCACAAACTTAAAGG + Intergenic
1159908856 18:74124192-74124214 ACATAAGAGCAAGAACTTGAAGG + Intronic
1159986729 18:74850659-74850681 GTATTTGAGCAGAAACTGAAAGG - Intronic
1160015888 18:75140392-75140414 ACATTTGAGCGGAGACTTGAAGG - Intergenic
1160042704 18:75360238-75360260 ACAAATGATCACAAACTTGAAGG + Intergenic
1160255726 18:77247185-77247207 ACATTTGAGTAGGAACCTGAAGG - Intergenic
1160644819 19:178604-178626 ACATTTAAGAATAGACTTGAAGG - Intergenic
1160661921 19:305304-305326 ATATTTAAGCTGAAACATGAAGG - Intergenic
1160702896 19:517223-517245 ACATTTGAGGAGAGACCTGGAGG + Intronic
1160741102 19:686297-686319 ACCTTTGAGCTGAGACTTGAAGG - Intronic
1161289362 19:3484851-3484873 ACATTTGAGCAAAGACCTGGAGG + Intergenic
1161492669 19:4570850-4570872 ACATTTGAGCTGAGGCCTGAAGG + Intergenic
1161599143 19:5170278-5170300 ACATTTGAGCAGAGACCTGAAGG + Intronic
1161846893 19:6716895-6716917 ACATTTGAGCAAAGACTTAAAGG + Intronic
1161875416 19:6904863-6904885 ACATTTAAGCAGAAACCTGAAGG + Intronic
1162360876 19:10219796-10219818 GCATTTGAGCAGAGTCCTGAAGG + Intronic
1162400645 19:10444570-10444592 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1162446219 19:10724510-10724532 ACATTTGAGCAGAGCCTTGAAGG + Intronic
1162754006 19:12846459-12846481 ACATTGAAGCAAAAATTTGAAGG + Intronic
1162819391 19:13213324-13213346 ACATGTGAGCAAAGGCTTGAAGG - Intronic
1162863254 19:13524395-13524417 ATATTTGAGCAGAGACATGAAGG + Intronic
1162864855 19:13538060-13538082 AAATTCAAGCAGACACTTGAAGG + Intronic
1163077204 19:14904658-14904680 ACATTTGAACAGAGACCTCAAGG + Intergenic
1163113473 19:15175718-15175740 CCATTTCAGCAAAGACTTGAAGG + Intronic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1163518562 19:17779094-17779116 ACATCTGAGCTGAGATTTGAGGG + Intronic
1163626064 19:18390461-18390483 ACATTTGAGCTGAGACCTGGAGG + Intergenic
1164403429 19:27919466-27919488 ACATTTGGTCAGAAAGTTGTGGG + Intergenic
1164478357 19:28592345-28592367 CCATTTGAGCAGACACTGGAAGG - Intergenic
1164926894 19:32137693-32137715 GCATTTGAACAAAGACTTGAAGG - Intergenic
1165322503 19:35094782-35094804 ACTTTGGAGCAGAGACTTGCTGG + Intergenic
1165339598 19:35201530-35201552 AAGTTTGAGCAGAGACTTAAAGG - Intergenic
1165438095 19:35807669-35807691 ACATTAGAGCAAATACTTGAAGG - Intronic
1165463935 19:35960848-35960870 ACATTTGAGCAAAGGCTTGAAGG - Intergenic
1165482652 19:36073856-36073878 ACATATGAGCAGAGACCTGCAGG + Intronic
1165606902 19:37113567-37113589 ACTTTTGAGCAGCATCTTGGAGG + Intronic
1165700467 19:37933320-37933342 ACATCTGAACAGAGACTTGAGGG - Intronic
1165731034 19:38144871-38144893 ACATCTGAACAGAAGTTTGAGGG + Intronic
1165813931 19:38629694-38629716 ACCTTTGAGCAGAAATCTGAAGG + Intronic
1165933435 19:39375009-39375031 ACACTTGAGATGAGACTTGAGGG + Intronic
1165940274 19:39411472-39411494 ACTTTTGAGCAGAGACATGAAGG - Intergenic
1165946563 19:39446490-39446512 ACATTTGAGCAAAAACTTGTTGG + Intronic
1166070669 19:40385509-40385531 ACATTTGAGTAAAGACCTGAAGG - Intronic
1166563702 19:43750374-43750396 ACTTTTTAGCAGAGACTTGAAGG - Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1166778109 19:45324465-45324487 ACATCTGAGCAGAGACCTGAAGG + Intergenic
1166804612 19:45478003-45478025 ACATTAGGGCAGACCCTTGAAGG - Intronic
1166807396 19:45495637-45495659 ACGTTTGAGCAGAGATCTGAAGG + Intronic
1166889164 19:45979841-45979863 ACATTTGAGCAGAGACCTGAAGG + Intergenic
1166952037 19:46435568-46435590 ACATTTGAGAGAAATCTTGATGG + Intergenic
1166983031 19:46642865-46642887 ACATTTGAACAGAGACCTGAAGG - Intergenic
1167109246 19:47449250-47449272 ACATTTGAGCAGAGACCTGAAGG + Intronic
1167139620 19:47640705-47640727 ACATTTGAACAAAGACCTGAAGG + Intronic
1167150596 19:47707164-47707186 ATATTTGAGCAGAGACATGCAGG + Intergenic
1167151344 19:47712054-47712076 ACATTTGAGCAGGGACCTGAAGG + Intergenic
1167161725 19:47772164-47772186 ACATTTGAGCAAAGATATGAAGG + Intergenic
1167242347 19:48351739-48351761 ACATTTGAGCAGAGACCTGAAGG - Intronic
1167656478 19:50767623-50767645 ACATTTGAGCAAAGATTTGGAGG - Intergenic
1167691444 19:50986447-50986469 ATATTTGAGCAAAGTCTTGAAGG + Intergenic
1167780533 19:51595935-51595957 AAGTTTGAGCTGAGACTTGAAGG + Intergenic
1167795908 19:51708472-51708494 ACGTTTGAATAAAAACTTGAAGG + Intergenic
1202646266 1_KI270706v1_random:144801-144823 AAAATTGAGCAAAGACTTGAAGG - Intergenic
924985695 2:267466-267488 ACTTTTGAGTAAAGACTTGAAGG + Intronic
925594956 2:5545896-5545918 ATATTTGAGCAGGACCTTGAGGG + Intergenic
926312540 2:11685135-11685157 ACATGTGAGCAAAGACTTGAAGG + Intronic
926560094 2:14407250-14407272 ACATTTGAGCTGAGGCCTGAGGG - Intergenic
926627183 2:15102000-15102022 ACATTTGAGCTGGGTCTTGAAGG - Intergenic
926650581 2:15339781-15339803 ACATTTGAGCAGACACCTGATGG + Intronic
926669510 2:15562949-15562971 ACATTTGAGCAAAAACTTGAAGG - Intergenic
926688982 2:15719746-15719768 ACATGTGAGAAGGAACCTGAAGG - Intronic
926694886 2:15764272-15764294 ACATTGGACCAGATACTTAAGGG - Intergenic
926879328 2:17525347-17525369 ACCCTTGAGCAGATATTTGAAGG + Intergenic
926909334 2:17835778-17835800 ACATTTGAGCAGACATCTGAAGG - Intergenic
927170569 2:20366089-20366111 GAATTTGAGCAGAAACCTGAAGG - Intergenic
927314617 2:21667446-21667468 AAATTTGAACAGCACCTTGAGGG - Intergenic
927411324 2:22829580-22829602 ATAATTGATCCGAAACTTGAAGG - Intergenic
927494702 2:23544685-23544707 ACATTTGAGAAGAGGCTGGAAGG + Intronic
927607303 2:24498054-24498076 ATATTTGACCAGATAGTTGAAGG + Intronic
927672791 2:25082902-25082924 ACATTTGGGCAGAGACCTTAGGG + Intronic
927734602 2:25507984-25508006 ACATTTGAACATCAGCTTGAAGG - Intronic
927877434 2:26668121-26668143 GCATTTGAGCTGAGACTTGAAGG + Intergenic
928386522 2:30873050-30873072 ACATTTGAGCAAACATTTGAAGG - Intergenic
928395491 2:30940545-30940567 ACATTTCAGCAGAGATTGGATGG + Intronic
928744539 2:34396194-34396216 ACATTTGAGCAGACACCTAAGGG + Intergenic
928873170 2:36006133-36006155 ACAAATGACCACAAACTTGATGG + Intergenic
929065764 2:37973658-37973680 AAATTGGAGCAGAGACTTGAAGG + Intronic
929098176 2:38283668-38283690 ACATTTGAGCAAAGACTTGGAGG - Intergenic
929443673 2:41986174-41986196 ATAGTTGAGCTGAGACTTGAAGG - Intergenic
929719400 2:44352087-44352109 ACATTTGAGCAATAGCTTTAAGG - Intronic
929723966 2:44403925-44403947 ACATCTGAGTTGAATCTTGAAGG - Intronic
929737716 2:44568101-44568123 ACAGTTGAGCATAAATCTGAAGG + Intronic
929818564 2:45255896-45255918 AGGTTTGAACATAAACTTGAGGG - Intergenic
929867836 2:45733611-45733633 AGGTTTGAGCAAAGACTTGAAGG + Intronic
930731346 2:54731065-54731087 GCATTTAAGCAGAAACCTGAAGG + Intronic
931054185 2:58450126-58450148 ACATCTGAGCAAAGACTTGAAGG - Intergenic
931629150 2:64283877-64283899 ACATTGGAGCTGAGACCTGACGG - Intergenic
931648973 2:64451931-64451953 ACATTTGAGAAGACCCCTGAAGG - Intergenic
931758596 2:65396279-65396301 ACATTTGAGTTGAGCCTTGAAGG - Intronic
931977517 2:67658853-67658875 ACATTTGAGCTGAAACCTGAGGG - Intergenic
932039913 2:68288311-68288333 ACATTTAAGCTGGCACTTGAAGG + Intronic
932087971 2:68779032-68779054 TCATTGTAACAGAAACTTGAGGG - Intronic
932230322 2:70078513-70078535 ACAGTTGAGCAGAAACCTGAAGG + Intergenic
932251047 2:70244210-70244232 ACATTTGAGGAAAAAAGTGAAGG - Intronic
932674890 2:73771009-73771031 TCATTTGAGCAGAACCTTAAAGG - Intronic
932682043 2:73834749-73834771 AGATTTGAGCTGAGACTTGAGGG + Intronic
932822899 2:74916457-74916479 ATATTTGAGCAGAGGCCTGAAGG + Intergenic
933241024 2:79920281-79920303 ATATTTGAGCTGAAACTTGGTGG - Intronic
933627071 2:84613194-84613216 GCTTTTGAGCAGAAACCTGCAGG + Intronic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
933873298 2:86591922-86591944 ACATTTGGGGAGAAATGTGAAGG + Intronic
934035774 2:88087549-88087571 ACATTTGAGCTGGAATTGGAAGG - Intronic
934102805 2:88668903-88668925 ACATTTGAGCTGAGCCCTGAAGG - Intergenic
934509407 2:94925230-94925252 AAAATTGAGCAAAGACTTGAAGG - Intergenic
934726405 2:96622882-96622904 ACATTTGAGCAACAACCTGAAGG - Intronic
934869987 2:97854848-97854870 ACATTTGAACAAAGACTCGAAGG - Intronic
935364147 2:102271596-102271618 TCATTTCAGCAGAACCTTGAAGG + Intergenic
935402788 2:102678038-102678060 ACATTTGAGCAACACCTTCATGG - Intronic
935553828 2:104485435-104485457 GCATTTGAACAAAGACTTGAAGG - Intergenic
935553987 2:104486704-104486726 ATATTTTAGCAGAGACTTGAAGG - Intergenic
935680449 2:105631638-105631660 AAATGTGACCAGAAGCTTGAAGG + Intergenic
935720545 2:105975229-105975251 ACATTTGAGCAAAGACCTGAAGG - Intergenic
936491779 2:112978456-112978478 ACATCTGGGACGAAACTTGAAGG - Intronic
936653211 2:114454123-114454145 ATCTTTGAACTGAAACTTGATGG + Intronic
936926172 2:117739213-117739235 TCATTTCAGCAGAAGTTTGAAGG - Intergenic
937261340 2:120588366-120588388 ACACCTGAGCAGAGACCTGAGGG + Intergenic
937398121 2:121556573-121556595 ACATTTGAACAAAGACTTGAAGG - Intronic
937525411 2:122762755-122762777 ACATTTCAGCAGAAACTTTTTGG - Intergenic
937674073 2:124570289-124570311 ACCTTTTAGCAGAGATTTGAGGG + Intronic
937684444 2:124680177-124680199 ACATTTATGCTGAACCTTGAGGG - Intronic
937840056 2:126515742-126515764 ACATGTGAGCTGACTCTTGATGG - Intergenic
938317362 2:130339411-130339433 ACATTTTAGCAAAGACCTGAAGG - Intronic
938320658 2:130360069-130360091 CCATTTGAGCAAAGACCTGAAGG - Intronic
938574589 2:132592283-132592305 ACATTTGAGCAAAGACCTGAAGG + Intronic
938644216 2:133314847-133314869 ACATTTGAGCAAACACCTAAAGG + Intronic
938714399 2:134006347-134006369 ACATTTGACCTGAACCTTAAAGG - Intergenic
938765481 2:134458321-134458343 ACATTTGAGCAGAGACTTGATGG - Intronic
939008732 2:136819979-136820001 ACATTAGAGCAAAGACTTGAAGG - Intronic
939046713 2:137258518-137258540 ATATTTGAGTAAGAACTTGAAGG - Intronic
939087164 2:137735257-137735279 ATTTTTCAGCAGAAACTTGCAGG - Intergenic
939127375 2:138193561-138193583 ACATTTGAGCTACAACTTAAAGG - Intergenic
939225855 2:139363311-139363333 ACATTTGTTCAAAATCTTGAAGG + Intergenic
939316535 2:140557744-140557766 ATATTTGAGCAAAATCCTGAAGG - Intronic
939325213 2:140679349-140679371 ACAGATGAACAGAAACTTAAGGG - Intronic
939333686 2:140797932-140797954 ACAGTTGAGCAAAAATCTGAAGG - Intronic
939766447 2:146255998-146256020 ACATTTGAACACAGACCTGATGG - Intergenic
939897421 2:147808830-147808852 ACATTTGAGCAGAGACTTGAAGG - Intergenic
940078913 2:149778026-149778048 ACATTTGAGCAGAGACTTGAAGG + Intergenic
940228072 2:151421317-151421339 ACATTTGAACAGTGATTTGAAGG + Intronic
940619546 2:156093853-156093875 ACATTTGTGCAGAAATCTGAAGG - Intergenic
940979775 2:159988559-159988581 ACATTTGAGCTGAATTTTGAAGG + Intronic
941032114 2:160524501-160524523 ACATTTGAGCAGATATCTGAAGG + Intergenic
941064687 2:160888632-160888654 ACTTTTGAGCAAAGACTTGAAGG + Intergenic
941187961 2:162340864-162340886 AGATTTGAGCAAAAACTTAGAGG - Intronic
941442442 2:165555076-165555098 ACATTTGAACAAAGACCTGAAGG - Intronic
941690578 2:168497528-168497550 ACCTCTGAGCAGAGACCTGAAGG + Intronic
941707088 2:168670657-168670679 ACCTTTGAGCAAAAGCCTGAAGG - Intronic
941807713 2:169725492-169725514 GCATTTGAGCAAAAACCTGATGG + Intronic
941900685 2:170675424-170675446 ACATTTGAGCTAAGATTTGAAGG + Intergenic
942484908 2:176428691-176428713 ACATTTTAGCTAAGACTTGAAGG - Intergenic
942501051 2:176591622-176591644 ACATTTGAGTCGAGTCTTGAGGG - Intergenic
942579487 2:177402201-177402223 ACATTTGAGCAGATATTTAAAGG + Intronic
942653078 2:178188951-178188973 ACACTTAAGCAAAGACTTGAAGG - Intergenic
943051836 2:182922596-182922618 ACATTTGAGCTGGTACGTGAAGG - Intronic
943138887 2:183952492-183952514 ACATCTAAGCAGAAGCTTTAAGG - Intergenic
943534521 2:189131138-189131160 GAATTTGAGCAGAGACCTGAGGG + Intronic
943594668 2:189841978-189842000 ACATTTGACCAGGAAACTGAAGG - Intronic
943614742 2:190080466-190080488 ACATTTGAGCTGGATCTTGAAGG + Intronic
943642681 2:190376330-190376352 ACATTTGAGCAAAGTTTTGATGG - Intergenic
943683634 2:190793579-190793601 ACATTTGAACTGAAACTTAAGGG + Intergenic
943718254 2:191175863-191175885 ACATCTGAGCTGAACCTTGGGGG + Intergenic
943855264 2:192782487-192782509 ACATTTGAGCAGAATACTGAAGG + Intergenic
944004646 2:194889881-194889903 AAACTTGAGCAAAGACTTGAAGG + Intergenic
944219494 2:197288283-197288305 ACATCTGAGAGGAAACTTCATGG + Intronic
944448482 2:199816695-199816717 ATATTAGAGCAAAGACTTGAAGG - Intronic
944465744 2:199997784-199997806 ACATTTGGGCAGAGACTTCCGGG - Intronic
944509503 2:200450889-200450911 ACCTTTGAGCAGGATCTTGAAGG + Intronic
944555980 2:200888293-200888315 ACATTTAAGCAGAAATTTGGAGG - Intronic
944884489 2:204048815-204048837 ACATCTGAGCAGAACTTTGAAGG + Intergenic
945199969 2:207271856-207271878 ACCTTTGAGCAGAGATCTGAAGG + Intergenic
945385419 2:209193621-209193643 ATATTTGAGCAAAAACTTAAAGG - Intergenic
945470406 2:210222575-210222597 AGATTTGAGCAAACCCTTGAAGG + Intronic
945511243 2:210705778-210705800 ATATTTGAACTGAATCTTGAAGG + Intergenic
945567325 2:211416863-211416885 ACATTTTGGCAGAGACTTAAAGG - Intronic
945607204 2:211949747-211949769 ATATTTGAGCAAAAACTTGAAGG - Intronic
945895968 2:215482004-215482026 ACATTTGAGCCAAGACTTGAAGG + Intergenic
945942024 2:215959822-215959844 GCATTTGAGCTGAGCCTTGAAGG - Intronic
945981842 2:216318544-216318566 AAATTTGAGCAGAGACTGGAAGG + Intronic
946236630 2:218328306-218328328 AAATTTGAGCAGAGACCTGAAGG - Intronic
946721698 2:222615625-222615647 ACATTTGAGCAGACACTTGAAGG - Intronic
947087296 2:226467596-226467618 ACATTTTGACAGAAACTTAAAGG - Intergenic
947202148 2:227623390-227623412 ACATTTGAACAAAGACTTAAAGG + Intronic
947625243 2:231614605-231614627 ACATTTGTGCGCAAAGTTGACGG + Intergenic
948345579 2:237294709-237294731 TCATTTGAACAGACAATTGAAGG - Intergenic
948528371 2:238587463-238587485 ACATTTGAGCCAAGACTTGAAGG + Intergenic
948623093 2:239249104-239249126 GCATTTGAGCCGACACCTGAAGG + Intronic
949084109 2:242134809-242134831 ACATTTAAGAATAGACTTGAAGG + Intergenic
1168749852 20:274718-274740 ACATTTGAACTGAGGCTTGAAGG - Intronic
1168812631 20:715677-715699 ACATTTGAACACAAACTTGAAGG + Intergenic
1168857687 20:1020209-1020231 ACATTTGAGCAGAAGCCTGAAGG + Intergenic
1168878622 20:1187127-1187149 GCATTTGAGCAAAGACTTGAAGG - Intronic
1168886713 20:1265250-1265272 ACATTTGAGCAGAGACCTGGAGG + Intronic
1168903498 20:1385867-1385889 ACATTTGAGCAAAGACTTGAAGG - Intronic
1168908079 20:1422877-1422899 ATATTTGAGCAGAGACCTAAAGG - Intergenic
1168914192 20:1472960-1472982 ACATTTGAGCAGACACCTGAAGG - Intronic
1168949557 20:1787292-1787314 ACATTTGAGCTGAGACCTGAAGG - Intergenic
1169150960 20:3288990-3289012 ATATTTGAGCAGAGACTTTAAGG - Intronic
1169411171 20:5371661-5371683 ACATTTGAGCAAAGATTTGAGGG - Intergenic
1169539313 20:6582023-6582045 ACATTTGAACAAAGACTTGAAGG + Intergenic
1169864964 20:10190119-10190141 ACATTTGAGTTGAGATTTGAAGG + Intergenic
1169998630 20:11588491-11588513 TCATTTGAGAAAAAAGTTGATGG + Intergenic
1170071446 20:12373582-12373604 AAATTTGAGCACAGGCTTGAAGG - Intergenic
1170138659 20:13103361-13103383 ACATTTGGGCTGAATCTTGAAGG + Intronic
1170154260 20:13255193-13255215 ACATTTAAGCTGAGACTTGAAGG + Intronic
1170175223 20:13461179-13461201 ACATTTGAGCAGAAATCCAAAGG - Intronic
1170396048 20:15926644-15926666 ACATTTAAGCAGTAACTTGAAGG + Intronic
1170405167 20:16028134-16028156 ACATTTGAGTTGGAACTAGATGG - Intronic
1170426728 20:16242620-16242642 GCATTTGAGCAAAGACTTGTAGG + Intergenic
1170436960 20:16340235-16340257 ACTTTTGAGCAAAGACTTGAAGG - Intronic
1170446338 20:16431755-16431777 GCTTTTGAGCAGAGACCTGAAGG - Intronic
1170677203 20:18493521-18493543 ACATTTGAGCAGACACTTCAAGG + Intronic
1170799537 20:19579654-19579676 CCATTTGAGCAGGGACCTGAAGG + Intronic
1170855640 20:20051831-20051853 ACCTTTAAGCTGAGACTTGAAGG - Intronic
1170898522 20:20437667-20437689 GCATTTGAGCAAAGACCTGAAGG - Intronic
1171981149 20:31630147-31630169 ACATTTAAGCTGCAATTTGAAGG + Intergenic
1172069555 20:32246557-32246579 ACATTTGAGCAGAGGCCTGAAGG + Intergenic
1172114323 20:32564732-32564754 ACCTTTGTGCAGCACCTTGAAGG - Intronic
1172180440 20:33000269-33000291 ACATTTGAGCTGAATCCTGAAGG - Intronic
1172193096 20:33074161-33074183 ACATCTGAGCTGAATTTTGAAGG + Intergenic
1172211017 20:33198613-33198635 GCATTTGAGCAGAGACCTGAAGG - Intergenic
1172240880 20:33411876-33411898 ACATTTGAGCTGGACTTTGATGG - Intronic
1172281851 20:33713375-33713397 ACATTGGAGTAAAGACTTGAAGG - Intronic
1172283024 20:33721256-33721278 GCATTTGAGCTGAAACCTGAAGG - Intergenic
1172291455 20:33780124-33780146 ACATTTGAGCTGAGATATGAAGG + Intronic
1172416700 20:34775002-34775024 AGATTTAAGCTGATACTTGAAGG + Intronic
1172430657 20:34888736-34888758 ACATTTGAGCAGAGATCTGAAGG + Intronic
1172435245 20:34924436-34924458 ACATTTGAGCAGAGGCCTGAAGG + Intronic
1172460756 20:35116577-35116599 GCATTTGAGCAGAGACCTGAAGG - Intronic
1172470602 20:35191588-35191610 ACAGTTGAGCAGAGATATGAAGG + Intergenic
1172509736 20:35492138-35492160 ACATCTGAGCTGAGACTTGAAGG + Intronic
1172699023 20:36841471-36841493 ACATTTGAGCTGAGACAAGAAGG + Intronic
1172715196 20:36957951-36957973 ACATTTGAGCAGAGAGTTGAAGG + Intergenic
1172899010 20:38320557-38320579 ATATTTGAGCAAAGACTTGAAGG - Intronic
1173077895 20:39837900-39837922 ACATTTAAGCAGCAATTTGAAGG + Intergenic
1173164582 20:40678021-40678043 AGATTTCAGCAAGAACTTGAAGG + Intergenic
1173175026 20:40758059-40758081 ACATTTGAGCAAAGATTCGAAGG - Intergenic
1173193600 20:40895642-40895664 ACCTTTGGGCTGAAACCTGAAGG + Intergenic
1173226823 20:41167036-41167058 ACATCTGAGCAGCATCTTTAAGG + Intronic
1173255303 20:41390381-41390403 ATATTTGAGCTGAGCCTTGAAGG - Intergenic
1173262768 20:41451417-41451439 ACATTTGACCTAAAACTTCAAGG + Intronic
1173268226 20:41506480-41506502 ATATTTGAGCAAATAATTGAAGG - Intronic
1173284834 20:41660888-41660910 ACATTTGAGCAAAGACCTAAAGG - Intergenic
1173316989 20:41953938-41953960 ACATTTAAGCTGAGATTTGACGG - Intergenic
1173333564 20:42095514-42095536 ACATTTGAACACAGACGTGAAGG - Intronic
1173367196 20:42396918-42396940 GCATTTGAACAGAGACCTGAGGG - Intronic
1173510654 20:43625552-43625574 ATATTTGAGGAAAAACCTGAAGG + Intronic
1173559396 20:43992082-43992104 ACATTTGAGCAACGACTTGAAGG + Intronic
1173576855 20:44117691-44117713 CCATTTGAGCTGAATCTTGCAGG - Intronic
1173587474 20:44193751-44193773 ACATTTGAGCAGAGACCTGAAGG - Intergenic
1173859030 20:46270020-46270042 ACATTTGAACTGATCCTTGAAGG + Intronic
1173861896 20:46289211-46289233 CCATTTGAGCAGACCCTCGAAGG - Intronic
1173886446 20:46463429-46463451 AGATTTCAGCAGAAACGTCAAGG + Intergenic
1173931013 20:46818611-46818633 ACATTGGAGCAGAGACCTGAAGG - Intergenic
1173953465 20:47011664-47011686 ACATTTGAACAAAGACCTGAAGG - Intronic
1173970290 20:47147363-47147385 ACTTTTGAGCAAAGACCTGAAGG + Intronic
1174142440 20:48425292-48425314 ACATTTGAGCAGAGTCCTGAAGG - Intergenic
1174180734 20:48672721-48672743 ACATTTGAGCAGAGGGCTGAGGG - Intronic
1174195470 20:48769720-48769742 ACGTTTGAGCAGAGACCTGAAGG - Intronic
1174279104 20:49425555-49425577 ACATATGAGCAGAAACCTAAAGG - Intronic
1174289896 20:49500612-49500634 AGCTTTGAACAGAAACTCGATGG - Intergenic
1174402705 20:50284413-50284435 ACGTTTGAGCAGAGACTTGAAGG - Intergenic
1174478019 20:50811004-50811026 ATATTTGAGCAAAAGCTAGAAGG + Intronic
1174765461 20:53249565-53249587 CCATTGGAGCTGAGACTTGATGG + Intronic
1174830439 20:53807266-53807288 ACATTTGAACAAAGACTGGAAGG - Intergenic
1174951796 20:55050447-55050469 ATATTTAAGCTGAGACTTGAGGG - Intergenic
1175114671 20:56673725-56673747 TCATTAGAGCGGACACTTGAAGG + Intergenic
1175140036 20:56854153-56854175 ACATTTGAGCAGAAACTGGAAGG - Intergenic
1175206529 20:57316028-57316050 GCACTTGAGCAGAAACCTAATGG + Intergenic
1175532344 20:59682664-59682686 ACATTTGAGCAAAGCCGTGAAGG + Intronic
1176280694 20:64307297-64307319 ACATTTAAGAATAGACTTGAAGG + Intergenic
1176605608 21:8827960-8827982 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1176876936 21:14139754-14139776 GCATTTGAGCAAAAGCTTGGAGG + Intronic
1177130851 21:17253249-17253271 ACATTTAAGTTGAAATTTGAAGG - Intergenic
1177501260 21:21959000-21959022 AAATTTGAGCAGAAAATTGAAGG + Intergenic
1177568350 21:22853163-22853185 ACATTTGATCAAAGACTGGAAGG + Intergenic
1177706361 21:24710909-24710931 ACATTTGGGTAGAATCTTTAGGG - Intergenic
1177779826 21:25610358-25610380 ACATTTCAGAATAAAGTTGAAGG - Intergenic
1177901047 21:26915472-26915494 ACATTTAAGTACAGACTTGAAGG + Intergenic
1178213495 21:30565429-30565451 ACATTGGTGCAGAAATTTTATGG + Intergenic
1178433540 21:32537203-32537225 GCATTTGAGCAGAAACCAGGAGG + Intergenic
1178563611 21:33662460-33662482 ACATTTGAGCAAATAGGTGATGG + Intronic
1178702038 21:34841742-34841764 ACATTTCAGCAAATACTTGAAGG - Intronic
1178755684 21:35347287-35347309 AAATTGGAGCAAACACTTGAAGG - Intronic
1178928735 21:36798038-36798060 ACACGTGAGCAGAGACTTGAAGG + Intronic
1179021052 21:37641549-37641571 ACATTTGAGCTAAGATTTGAAGG + Intronic
1179210645 21:39321722-39321744 ACATTTGAGCCAAGACTTGAAGG - Intergenic
1179399719 21:41072579-41072601 ACATTTGCACAAAGACTTGAAGG + Intergenic
1180347905 22:11719564-11719586 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1180355684 22:11837666-11837688 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1180382570 22:12154659-12154681 AAAATTGAGCAAAGACTTGAAGG - Intergenic
1180879121 22:19191494-19191516 TCATTTGAGCAAAAACTGGAAGG - Intronic
1181458344 22:23071777-23071799 ACATTTGAACTGGAGCTTGAAGG + Intronic
1181774138 22:25147593-25147615 ACATTTGAGCAAAGAGATGAGGG - Intronic
1181891544 22:26067816-26067838 ACATTTGAGCTGAGAGTTGAAGG - Intergenic
1182059249 22:27385352-27385374 ACATTTGAGCAGCAACTAGAAGG + Intergenic
1182142251 22:27970236-27970258 AGATTTGAACAAAAACTTCACGG - Intergenic
1182417326 22:30229587-30229609 ACATTTGAGCAGAGACCTGATGG - Intergenic
1182418144 22:30234634-30234656 ACATTTGAACAGGACCTTGAAGG + Intergenic
1182480870 22:30607927-30607949 ACATGGGAGCTGAAACTCGAAGG + Intronic
1182576711 22:31277903-31277925 ACATTTAAGCATAAACATGGAGG + Intronic
1182844547 22:33419529-33419551 ACATTTGAGCTAAGACCTGAAGG - Intronic
1182947587 22:34338995-34339017 AGATTTGAGCAAAAACATGAAGG - Intergenic
1183016014 22:34987770-34987792 ACATTTGAGCAAAATTTTGAAGG - Intergenic
1183135049 22:35879118-35879140 ACATTTGAGCAAAAATTTGAAGG + Intronic
1183317435 22:37144387-37144409 GCAGTTGAGCAGAAACTTGAAGG - Intronic
1183573193 22:38669672-38669694 ACATTTGAGCACTTACCTGAAGG + Intronic
1183868823 22:40725176-40725198 ACATTAGGGCAAAAACATGAGGG - Intergenic
1183991335 22:41598882-41598904 AGATTAGAGCAGAAACTAGCAGG - Exonic
1184313506 22:43664587-43664609 GCAGTTGAACAGAGACTTGAAGG + Intronic
1184574450 22:45351039-45351061 ACATTTGAGCAAAGATTTGAAGG - Intronic
949659493 3:6261597-6261619 AGTTTTGAGCAAAAACTGGAAGG - Intergenic
949879481 3:8650112-8650134 ACATTTGAGCAAAGGCCTGAAGG - Intronic
949986423 3:9544824-9544846 ACATTTGAGCTGAGTCTTAAAGG - Intronic
950148522 3:10668595-10668617 ACAACTGAGCAAAGACTTGAAGG - Intronic
950284733 3:11735758-11735780 ACATTTGAGCAGGAACGTGAAGG + Intergenic
950448088 3:13049604-13049626 ACATTTGAGCAGGGTTTTGAAGG - Intronic
950571420 3:13802557-13802579 ACATTTAAGCAAAGACTTGCAGG + Intergenic
950658790 3:14453797-14453819 GCCTTTGAGCAGAGACCTGAAGG + Intronic
950720364 3:14878065-14878087 ACTTTTGAGCAGAGACCTGAAGG + Intronic
950741619 3:15056778-15056800 ACAATTGACCACAAACTTGGTGG - Intronic
951034774 3:17921060-17921082 AAATTTAAGCAGAGACCTGAGGG + Intronic
951511466 3:23507186-23507208 ACATTTGAGCAGAGACATCAAGG - Intronic
951730853 3:25808753-25808775 ACATTTGAGCAAAGACCTGAAGG - Intergenic
951749505 3:26018650-26018672 ACATTTGAGATGAAAGCTGAAGG - Intergenic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
952240762 3:31529622-31529644 GTATTTGAGTTGAAACTTGAGGG - Intergenic
952525611 3:34207314-34207336 ACATTTAAGCAGAGAGCTGAAGG - Intergenic
952583110 3:34858146-34858168 ACATTTGAAAAGAAACTTGTAGG - Intergenic
952710608 3:36428606-36428628 ACCTTTGAGTAGAGACCTGAAGG + Intronic
952744743 3:36765817-36765839 ACATTTGAGTAAAAACCCGAAGG + Intergenic
952796907 3:37247479-37247501 ACATCTGAGTAGAGCCTTGATGG + Intronic
953008199 3:38997393-38997415 ACAGTTGAGCAGAGACTTAAAGG - Intergenic
953115848 3:39991669-39991691 ACATTTGAGCAAATACTTGAAGG - Intronic
953276432 3:41504149-41504171 ATATTTGAGCAGAGAAGTGAAGG - Intronic
953571395 3:44074587-44074609 ACATTTAGGCAGAAACCCGAAGG + Intergenic
953811928 3:46120190-46120212 ACATATGATCAGAAAGGTGATGG - Intergenic
953995355 3:47514919-47514941 ACATCGGAGCAGAGACCTGAAGG - Intergenic
954053064 3:47998416-47998438 ACATTAGAGAAGAAACATTAGGG + Intronic
954087975 3:48261293-48261315 ACATTTGAGCAAAGGCTTGAAGG + Intronic
954168836 3:48783194-48783216 ACATTCAAGCAGAAACCTAAAGG + Intronic
954299492 3:49691940-49691962 ACATTTTAGCAGAAACTTAGAGG + Intronic
954999351 3:54912591-54912613 ATATTTGAGGAGAGACCTGAAGG - Intronic
955088809 3:55729352-55729374 ACATTGGAGCAAGGACTTGAAGG - Intronic
955202952 3:56867813-56867835 ATATTTGAGCAGAGAACTGAAGG + Intronic
955483705 3:59414664-59414686 GCATTTGAGCTGAAACTTAGAGG - Intergenic
955692199 3:61601861-61601883 ATATTTGAGCAGAAATGTGAAGG + Intronic
955746743 3:62148199-62148221 ACATTTGAGCTCAGACATGAAGG + Intronic
956077118 3:65517283-65517305 ACATTGGAGCAAATTCTTGAAGG - Intronic
956331882 3:68119674-68119696 TCATTTGAGCAGATATGTGAGGG + Intronic
956374508 3:68600195-68600217 ACTTTTGATCAAAAACCTGAAGG + Intergenic
956379686 3:68652683-68652705 ACACTTGAGCAGAGACCTGAAGG + Intergenic
956381508 3:68669242-68669264 ACATATGAGCAGATACATGGAGG + Intergenic
956496314 3:69830399-69830421 ACATCTGAGCAAAGTCTTGAAGG - Intronic
956674512 3:71721845-71721867 ACATGTGAGCAGAGGCTTGAAGG + Intronic
956796092 3:72720003-72720025 AGCCTTGAGCAAAAACTTGAAGG + Intergenic
956836315 3:73099111-73099133 ACATGTGAGCAGAGATTGGAAGG + Intergenic
956894984 3:73650308-73650330 ACATTGGAGTGGAGACTTGAAGG + Intergenic
957120352 3:76082612-76082634 ATATTTGAGCAGAGACTTGAAGG - Intronic
957127461 3:76180091-76180113 ACCTTTGATCTGAATCTTGAAGG - Intronic
957363262 3:79186674-79186696 AAATGTGAGCAGAAGATTGAAGG + Intronic
957845919 3:85735259-85735281 ACATTTGAACAGAAAATTGATGG + Intronic
957913541 3:86655290-86655312 ACATTTCAGTAGAGACCTGAAGG - Intergenic
958157601 3:89774370-89774392 ATATTTGAGCAGAGACCTGAAGG - Intergenic
958446586 3:94222989-94223011 GAATTTAAGGAGAAACTTGAAGG - Intergenic
958699831 3:97574373-97574395 ACACTTAAGCAGAGTCTTGAAGG + Intronic
958708149 3:97682904-97682926 ACATTTCAGCTGTAACTAGATGG - Intronic
959067197 3:101669726-101669748 ACATATGAGCAAAAACTTTTTGG - Intronic
959123576 3:102263057-102263079 ACATTTGAGCAGCCACTAAAAGG + Intronic
959166754 3:102789708-102789730 AGATTTGAGCAGAAAGGGGAGGG - Intergenic
959262672 3:104101566-104101588 ACATTTTAGCAGAAACAAGCCGG - Intergenic
959343506 3:105161947-105161969 ACATTTGATCAAAGACTTAAAGG - Intergenic
959384721 3:105688991-105689013 ATATTTGAACAGAAACTTGAAGG - Intronic
959426285 3:106192929-106192951 ATATTTGAGCAAAGACATGAAGG - Intergenic
959689460 3:109182812-109182834 ACATTTGAGCAGAGACGTGGAGG - Intergenic
959896600 3:111613671-111613693 ACATTTGTCCAGAAACTAGATGG + Intronic
959993053 3:112649736-112649758 ACATTTGAGTAGAGTCTTGAAGG - Intergenic
960031224 3:113056801-113056823 ACATTTGAGCTGAGTGTTGAAGG - Intergenic
960155879 3:114296862-114296884 ACATTTGAAAGGAAACTTTAAGG - Intronic
960173789 3:114493659-114493681 ACATTTGAGATGACACCTGAAGG - Intronic
960306005 3:116061515-116061537 ACATTTGAGTAAAGACCTGAAGG - Intronic
960433711 3:117600386-117600408 AGATTTGAACTGAAACTTGGTGG + Intergenic
960623340 3:119657076-119657098 ACATTTGAGCTGAATTTTGAGGG + Intronic
960926456 3:122799331-122799353 GTATTTGAGCAGACACCTGAAGG + Intronic
961051613 3:123751823-123751845 ACATCTGAGAACAGACTTGAAGG + Intronic
961570296 3:127792954-127792976 ACATCTGGGCAGAAACTGAAGGG + Intronic
961831415 3:129624979-129625001 ATATTTGAGCAGAAACCTGAGGG - Intergenic
961907870 3:130281399-130281421 ACACTTGAGCAAAGATTTGAAGG + Intergenic
962076770 3:132090406-132090428 ATATTTGAGCAAAGGCTTGAAGG - Intronic
962109706 3:132431456-132431478 ACATTTGAACACAGATTTGAAGG + Intronic
962111723 3:132457733-132457755 ACATTTGATCTGAATCTTGAAGG + Intronic
962200009 3:133393195-133393217 GCATTTGAACAGAGACCTGAAGG - Intronic
962301088 3:134243713-134243735 ACATTTGAGCCTCATCTTGAAGG - Intronic
962302382 3:134253739-134253761 ACATCTGAGCATAGATTTGAAGG - Intergenic
962314340 3:134349831-134349853 ACATTTGAGCAAAGATTTGAAGG - Intergenic
962357094 3:134704193-134704215 ACATTTGAGTTGGAATTTGAAGG - Intronic
962829661 3:139128922-139128944 ACATTTGAACTGAATTTTGAAGG + Intronic
962831872 3:139149666-139149688 ACATTTAAGCAGAGACTTTAAGG + Intronic
962858614 3:139374560-139374582 ACATGTGTGCAGACACTGGAAGG - Exonic
963068467 3:141282325-141282347 ACATTTGAGCAAAGACTTAAAGG - Intronic
963093096 3:141504993-141505015 ATATTTAAGCAGATACCTGAAGG - Intronic
963631996 3:147745039-147745061 ACATTTGAGCAAATACTTGAGGG + Intergenic
963662435 3:148144034-148144056 ACATTTGAACAAAGACTTGAAGG + Intergenic
963900660 3:150730104-150730126 ATATTTGAGCAAATGCTTGACGG - Intergenic
964246989 3:154665614-154665636 ATACTTGAGCAGAAACTTGAAGG + Intergenic
964291109 3:155181369-155181391 AGATTTAAGCACAAACTTTAGGG + Exonic
964677290 3:159297822-159297844 TCATTTGAGCAAAGACCTGATGG - Intronic
964709090 3:159652689-159652711 ACATCTGAGCTGAAACCAGAAGG + Intronic
964712035 3:159681461-159681483 GCATGTGAGCAGGAACTGGAGGG - Intronic
964719885 3:159761029-159761051 ACATTTAAGCTGAGACTTGAAGG + Intronic
964816849 3:160726977-160726999 ACATTTGAGCAGAGACCTGTAGG - Intergenic
965341478 3:167497073-167497095 ACATTTGAGCTGGGACTTAAAGG - Intronic
965376962 3:167936879-167936901 ACTTTTGAGCAAAGCCTTGAAGG + Intergenic
965632790 3:170750473-170750495 GCATTTGAGCTGAGATTTGAAGG - Intronic
965691761 3:171364794-171364816 ACATTTGAGCTGAGACCTGAAGG + Intronic
965951404 3:174312306-174312328 TCAATTGAGGATAAACTTGAGGG - Intergenic
966007403 3:175032834-175032856 ACATTTGGGCATAAAGTGGATGG + Intronic
966240571 3:177751575-177751597 ACATTTAAGCTGAGACCTGAAGG + Intergenic
966369559 3:179234021-179234043 ACATTTGAGCAAAGACCTGAAGG + Intronic
966632289 3:182091199-182091221 ACATGTGAACAAAAACTTGAAGG - Intergenic
966633499 3:182106085-182106107 GCATTTGAGCTGAAACCTGAGGG - Intergenic
966677420 3:182604348-182604370 ACATTCGAACTGAGACTTGAAGG - Intergenic
966781404 3:183587416-183587438 ATATTTGAGCAGAGATCTGAAGG + Intergenic
967372002 3:188757060-188757082 GCATTTGAGCCGAACCTTCAAGG - Intronic
967387228 3:188923727-188923749 GCATTTGAGCTGAGCCTTGATGG + Intergenic
967409708 3:189154956-189154978 ACATTTGAGCAAAGACCTGAAGG + Intronic
967644405 3:191903811-191903833 ACATTTGGGCTTAATCTTGAAGG - Intergenic
967923224 3:194628159-194628181 ACTTTTGAGCAAAGACGTGAAGG + Intronic
967990999 3:195130740-195130762 ACATTTGTTCAGATTCTTGAAGG - Intronic
968121893 3:196131709-196131731 AGGTTTGAACAAAAACTTGAAGG + Intergenic
968400229 4:288540-288562 TCATTTGAGCATATACATGATGG + Intronic
969063575 4:4459585-4459607 ACATTTAAGCTGAGACTTGAAGG + Intronic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
969317786 4:6392496-6392518 GCATTTGAGCAGAGACCTGAAGG + Intronic
969480479 4:7444421-7444443 ACATTTGAGTGTAAACTTGGAGG + Intronic
969501414 4:7555764-7555786 GCATTTGAGCCTAAACCTGAAGG + Intronic
969602809 4:8187049-8187071 ACATTTGAGCAGGGCTTTGAAGG - Intronic
969648130 4:8445589-8445611 ACATTTGAGCAGAGAGCCGAAGG - Intronic
969940185 4:10724292-10724314 ACATGTGAGCAACAACTTGAAGG - Intergenic
969990016 4:11252682-11252704 GCTTTTGAGCAGAAACTTAAAGG - Intergenic
970012884 4:11479986-11480008 GCATGTGAGCAGAACCCTGAAGG + Intergenic
970026501 4:11629694-11629716 ATATTTGAGTAAAGACTTGAAGG + Intergenic
970331267 4:14986727-14986749 ACATTTGAGCTGTACATTGAAGG - Intergenic
970369635 4:15394053-15394075 AAGTTTGAGCAGAACCCTGAAGG + Intronic
970500132 4:16668501-16668523 GCATGTGAACAGAAACTTGGTGG - Intronic
970621954 4:17831592-17831614 ACATTTGAGCAAATACCAGAAGG + Intronic
970717887 4:18948710-18948732 AAATATGAGCAAAGACTTGAGGG - Intergenic
970935897 4:21569614-21569636 GCATTTGAGAAGAAACTTGAAGG + Intronic
971050107 4:22851904-22851926 ATATTTGAGCTAAATCTTGAAGG - Intergenic
971349174 4:25841366-25841388 ACATTTTGACAGAGACTTGAAGG - Intronic
971485907 4:27159980-27160002 ACATTTAAGGAAAGACTTGAAGG - Intergenic
971602436 4:28611219-28611241 TCAGTTGAGGAGAACCTTGAAGG + Intergenic
971751210 4:30650690-30650712 ACATTTGTTCAGAAATTTGATGG - Intergenic
972088323 4:35248665-35248687 ACATTTGAGCAGAGACATGAAGG + Intergenic
972187129 4:36543047-36543069 ACATTTGAGCAGTAAAGTAATGG + Intergenic
972326075 4:38016443-38016465 ACATTTCAGCAGAGACCTAAAGG - Intronic
972357315 4:38292149-38292171 ACATTTGATCAAAAATCTGAAGG - Intergenic
972423351 4:38910663-38910685 ACATGTGAGCAAATCCTTGAAGG + Intronic
972547641 4:40095739-40095761 ACACTTGAACAAAAATTTGAAGG + Intronic
972789186 4:42354445-42354467 AAATTTGAGCTGAAGCTTAAAGG + Intergenic
973256876 4:48122406-48122428 AGATTTGAGCAAAGACTTGGAGG - Intronic
973372502 4:49263029-49263051 AAAATTGAGCAAAGACTTGAAGG - Intergenic
973388501 4:49532112-49532134 AAAATTGAGCAAAGACTTGAAGG + Intergenic
973554398 4:52067607-52067629 ACATTTAAGCTGAGACTTGGAGG - Intronic
973873104 4:55186386-55186408 CCATTTGAACTGAACCTTGAAGG - Intergenic
973936943 4:55855682-55855704 ACATTTTAGCACAATCTTGAGGG + Intronic
973977777 4:56280425-56280447 ACATTTGTGCAGAAAACTCAAGG - Intronic
974075666 4:57166094-57166116 ACTTTTGAGCTGGACCTTGAAGG + Intergenic
974356220 4:60816069-60816091 ACATTTGAGCTGAGACTTGAAGG - Intergenic
974388479 4:61233552-61233574 ACATTTGAACAAAGAGTTGAAGG + Intronic
974471187 4:62319877-62319899 ATATTTGAACAGAAACTTGAAGG + Intergenic
974476713 4:62391040-62391062 TCATTTAAGCAAAGACTTGATGG - Intergenic
974578508 4:63761944-63761966 ATATTTGAGCAGGTACTTGAAGG - Intergenic
974782346 4:66569462-66569484 ACATTTAAGCACAGACCTGAAGG - Intergenic
974869900 4:67628447-67628469 ACATTTTAGCAGAAACCTGAAGG - Intronic
974910489 4:68112331-68112353 ACATTTAAGCTGGATCTTGAAGG - Intronic
975156181 4:71075631-71075653 ACATTTGAGCGGAGACCTGAAGG - Intergenic
975319879 4:72997721-72997743 ACATTGGAGCGAAGACTTGAAGG - Intergenic
975379407 4:73681047-73681069 ATATTTGAGCTCAGACTTGAAGG + Intergenic
975425210 4:74217225-74217247 ACATTTGGACAAAAACCTGAAGG - Intronic
975496852 4:75045093-75045115 ACATTTGAGCGAAGACTTGAAGG + Intronic
975528493 4:75376690-75376712 ACCTTTGAGCTGAATCTTGAAGG - Intergenic
975633857 4:76426426-76426448 AGGTGTGAGCAGAACCTTGAAGG + Intergenic
975648398 4:76567958-76567980 ACATTTGAGCAAATACCTGAAGG - Intronic
975684818 4:76909255-76909277 ACAGCTGAGCTGAATCTTGAAGG - Intergenic
975815455 4:78212231-78212253 ACATTTTAGATGAGACTTGAAGG - Intronic
975871233 4:78780924-78780946 ATCTTTTAGCAGAAACCTGAAGG + Intronic
975904906 4:79197870-79197892 ACATTTGAGCTGAATCATAAAGG + Intergenic
975923647 4:79423109-79423131 ACATTTGAGCAGAGACTGAAAGG + Intergenic
976006632 4:80438223-80438245 ACATTTGAATAAAAACGTGAAGG + Intronic
976106646 4:81625954-81625976 ACATTTAAGCAGAGACCTGAAGG - Intronic
976130447 4:81878408-81878430 AACTTTGAGCAGAAACTTTTAGG + Intronic
976133321 4:81908027-81908049 AAGTTGGAGCAGATACTTGAGGG + Intronic
976145503 4:82039211-82039233 AGATTTGAGCTGAACCTCGAAGG + Intronic
976149965 4:82081777-82081799 TCATTTGAGCAGAAACCTGAAGG + Intergenic
976269182 4:83213706-83213728 ACATGTGAGCAGAAATGTGGAGG + Intergenic
976351422 4:84064349-84064371 ACATTTGAGCTGAGATGTGAAGG + Intergenic
976796055 4:88934119-88934141 ACGTTTGAGTAGAGACTTGAAGG - Intronic
976951967 4:90844581-90844603 ACATTTGAGCAAATTTTTGAAGG - Intronic
976972508 4:91122956-91122978 AAATGTGAGCAGAAAATTCAGGG + Intronic
977011989 4:91647858-91647880 AAATTTGAGCAAAGACTTGAAGG + Intergenic
977048299 4:92094336-92094358 ACATTTGAACAAAGATTTGAAGG - Intergenic
977417571 4:96753379-96753401 ATATTTGAGCAGAGATCTGAGGG - Intergenic
977722636 4:100257881-100257903 ACATTTCAGCAAAAACCTCAAGG - Intergenic
977828691 4:101564321-101564343 ACATTTGAACAAGAACATGAAGG - Intronic
977914432 4:102575671-102575693 ACAACTGAGCAAAAACTTGAAGG - Intronic
978106487 4:104907720-104907742 ACATATGAGCTGAGATTTGAAGG - Intergenic
978314729 4:107423008-107423030 ACATTTAAGCAGGAACATGGTGG - Intergenic
978436224 4:108687241-108687263 ACCTTTGAACAAAGACTTGAAGG - Intergenic
978481115 4:109192032-109192054 CCATTTGAGCTGAGTCTTGAAGG + Intronic
978610104 4:110528424-110528446 ACATCTGAACAGAAAGTAGATGG - Intronic
978698990 4:111619504-111619526 ACATTTAAGCTGAGGCTTGAAGG - Intergenic
978717892 4:111868221-111868243 ACATTTGAACAGAGAAGTGAAGG + Intergenic
978779237 4:112532606-112532628 ACATGTGAGCACATACTAGAAGG + Intergenic
978792041 4:112672699-112672721 GCATTTGAGCAAAAACCTGAAGG + Intergenic
978921211 4:114184623-114184645 ACATTTGAGCAGAGACCTGAAGG - Intergenic
979261545 4:118653050-118653072 ACATTTAAGAATAGACTTGAAGG + Intergenic
979629911 4:122888688-122888710 ACATTTGAGCAAATGCTTGAAGG - Intronic
979927310 4:126583284-126583306 CCATTTCAGCAGAGAGTTGAGGG + Intergenic
979964042 4:127055870-127055892 ACATCTGTGCAGAAACCTGCTGG + Intergenic
980233697 4:130076542-130076564 ACATTTGTGCAGAATCTTGAAGG + Intergenic
980327793 4:131370978-131371000 ACATTTGAGCTGAGACTTGAAGG + Intergenic
980665712 4:135931200-135931222 ACATTTAAGAAAATACTTGAAGG - Intergenic
981016029 4:139975331-139975353 ACATTTGAGCAATTACATGAAGG - Intronic
981124557 4:141091028-141091050 ACATCTGGGTAGTAACTTGAAGG + Intronic
981132882 4:141177696-141177718 ACATTATAGAAGAAAATTGATGG + Intronic
981214613 4:142149727-142149749 ACCTTTGATCTCAAACTTGAGGG - Intronic
981403553 4:144341325-144341347 ACATTTGACCAAATACTTGAAGG - Intergenic
981426227 4:144606540-144606562 ACATCTGTGCAGTAACTTGAAGG - Intergenic
981503634 4:145477686-145477708 ACATTTGAGTGAAGACTTGAGGG + Intergenic
981595496 4:146416921-146416943 ACATTTGAGCAGAGACTTGAAGG - Intronic
981605858 4:146539324-146539346 ACATTTGTGCAGAGACTTAAAGG - Intergenic
981678400 4:147365877-147365899 ACATTTGAGCAAAGACTTGAAGG + Intergenic
981863180 4:149381602-149381624 ACATTTGAGCAAAGACCTGAAGG - Intergenic
981966923 4:150615032-150615054 ACCTTTGAGCAAAGACTTGAAGG + Intronic
982042026 4:151406899-151406921 ACATTTGAGGAACGACTTGAGGG - Intergenic
982081495 4:151794432-151794454 ACATTTAAGCAAAGACTTGATGG - Intergenic
982846094 4:160254181-160254203 ACATTTGAGCAGAAACCTGATGG - Intergenic
983150286 4:164270283-164270305 ACATTTAAGAATAGACTTGAAGG - Intronic
983905785 4:173181235-173181257 ACATTTAAGCAGAAGATTGCTGG + Intronic
983953683 4:173672786-173672808 ACATTTAAGCAGAGACTCAAAGG + Intergenic
984119542 4:175725026-175725048 CAATTTGAGCAAAATCTTGAAGG - Intronic
984143513 4:176033222-176033244 ACATTTCATCAGAGACCTGAAGG + Intergenic
984602364 4:181743481-181743503 ATATTTGAGCAAAGGCTTGAAGG + Intergenic
984613234 4:181865460-181865482 ACTTTTTAGCAGAAAACTGAAGG - Intergenic
984876069 4:184368832-184368854 AAATTTAAGCAAAAACTTGAAGG + Intergenic
985053874 4:186019172-186019194 ACATTTTAGCAAAGATTTGAAGG + Intergenic
985150741 4:186944788-186944810 ACATTTACGCAGAATTTTGAAGG + Intergenic
986234918 5:5899774-5899796 ACATTTCTGCAGAAAGTTAAAGG + Intergenic
986394562 5:7315721-7315743 ACATTTGAGCCAAGACTTGAAGG + Intergenic
986504792 5:8438630-8438652 ACACGTGAGCAAAAACTTAAAGG + Intergenic
986615959 5:9617781-9617803 ACATTTGAACAGAAATCTCAAGG - Intergenic
986822471 5:11482707-11482729 ACATTTGAACAAAGACTTGAAGG + Intronic
986875046 5:12097143-12097165 ACATTTGAGCAGGACCTTGGAGG + Intergenic
987031575 5:13980964-13980986 GCATTTGAGCAGGGACCTGAAGG - Intergenic
987049675 5:14138959-14138981 AAATTTGAGCTGAATTTTGAAGG + Intergenic
987167021 5:15209790-15209812 ACACTTGAGCTGAGACTGGAAGG - Intergenic
987456982 5:18159273-18159295 TCACTTGAGCAAATACTTGAAGG + Intergenic
988123918 5:27004152-27004174 ACATTTGAGCAGAAAGCTGAAGG + Intronic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
988415759 5:30945215-30945237 ACATTTGAGCTGAACTCTGAAGG - Intergenic
988459171 5:31417146-31417168 ACATCTGAACAGAGACCTGAAGG + Intronic
988789647 5:34595546-34595568 ACATTTGAGCAGAGAACTGAGGG - Intergenic
988875119 5:35436066-35436088 ACATTTGAGCTTAAGCTTAATGG + Intergenic
988908596 5:35816061-35816083 ACATTTGAGCAGAGACCCGGAGG - Intergenic
989031564 5:37124515-37124537 ACTTATGAACAGAAAATTGAAGG + Intronic
989100546 5:37818824-37818846 ACATTTGAGCAAAGACTTGAAGG - Intronic
989616168 5:43338937-43338959 ACACTTAAGCTGAGACTTGAAGG + Intergenic
989763588 5:45050832-45050854 ACATTTGAACAAAAACATAAAGG - Intergenic
990209719 5:53469504-53469526 ATATTTGAGCAGAGATCTGAAGG + Intergenic
990383687 5:55238980-55239002 ACATTTGAGCAAAGACCTGAAGG + Intergenic
990703148 5:58497251-58497273 CCATTTAAGCTGAGACTTGAAGG + Intergenic
990827209 5:59914379-59914401 ATTTTTGAGCAGAGACCTGAGGG + Intronic
990886303 5:60598269-60598291 CCATTTGAGCAGAAGCTGGTGGG - Intronic
990920767 5:60963870-60963892 ATATTTGAACAAAGACTTGAAGG + Intronic
991260523 5:64662765-64662787 GTATTTGAGCAAAGACTTGAAGG - Intergenic
991272677 5:64803579-64803601 ACATTTGAGCAAAGATCTGAAGG + Intronic
991290112 5:65025377-65025399 CCATTTGAGTAAAGACTTGAAGG - Intergenic
991398048 5:66225194-66225216 ACATTTAGGCAAAGACTTGAAGG + Intergenic
991398163 5:66226076-66226098 ACAAATGACCACAAACTTGATGG + Intergenic
991496950 5:67236321-67236343 GCATTTGAGTTGAAACTTGAAGG + Intergenic
992066930 5:73117847-73117869 AGATTGCAGCAAAAACTTGAAGG - Intergenic
992486930 5:77206470-77206492 ACGTTTGAGCAGAGACTTGAAGG + Intergenic
992596503 5:78352897-78352919 ACAATTGAGCAAAGACTTGCAGG + Intergenic
992816239 5:80442459-80442481 ACATGTGAGCAGAGTCTTGAAGG + Intronic
992904092 5:81328176-81328198 ACATTTGAGCAAAAGCCTGCAGG - Intergenic
992953266 5:81881648-81881670 ACATTTGGGCAAAGACCTGAAGG + Intergenic
993038454 5:82784361-82784383 ATGTTTGAGCAAACACTTGAAGG - Intergenic
993057127 5:82994181-82994203 ACAACTGAGCAGAAAACTGAAGG - Intergenic
993300104 5:86198183-86198205 ACAATTATGCTGAAACTTGAAGG + Intergenic
993378916 5:87183271-87183293 ACTTTTGAGCAAAGACTTGAAGG + Intergenic
993509594 5:88754950-88754972 GATTTTGAGCAGAGACTTGAAGG - Intronic
993552031 5:89285082-89285104 ACTTTTGAGCAAAAAATTGAAGG - Intergenic
993724553 5:91353010-91353032 ACATTTGAGGAGACACTGCAAGG - Intergenic
993842844 5:92901647-92901669 TCATTTGAGCAGAGTCTAGAAGG - Intergenic
993881235 5:93364035-93364057 TCATTTGATAGGAAACTTGAAGG + Intergenic
993886916 5:93425680-93425702 ATATTTGATCAGAGCCTTGAAGG - Intergenic
994044106 5:95288913-95288935 ATATTTGAGCAGAAACCCAAAGG + Intergenic
994055905 5:95414749-95414771 ATATTTGAACAGAAACCTGGAGG - Intronic
994236143 5:97365369-97365391 ACATTTGAGTCAAGACTTGAAGG + Intergenic
994719427 5:103364015-103364037 ACATTTGCGCAGAGGCCTGAAGG + Intergenic
994991638 5:107004271-107004293 ACATTTAAGCAGTATCTTGTGGG - Intergenic
995387302 5:111602166-111602188 ATATTTCAGCAGAGACTTTAAGG - Intergenic
995668981 5:114578649-114578671 ACATTTAAGCAGAATGTTGGGGG + Intergenic
995787423 5:115844449-115844471 GCATTTGAGCAAAGACTTGAAGG + Intronic
995793216 5:115915721-115915743 ACATTTGAACAAAAACCTGAAGG + Intergenic
996093753 5:119376864-119376886 ACATTTGAGCAGAGGCATGAAGG - Intronic
996160890 5:120162969-120162991 ATATTTTAGAAGAAATTTGATGG + Intergenic
996337606 5:122401783-122401805 ACATTTGAGCAGCACCTGGCTGG - Intronic
996464194 5:123780836-123780858 ACATTTTAGCAGAAACTATTTGG + Intergenic
996785397 5:127231448-127231470 CCATTTAAGCAGAGACCTGATGG - Intergenic
996834223 5:127773023-127773045 ATATTTGAGGAGAAAGTTGAGGG + Intergenic
997011448 5:129883334-129883356 ACATATGAGCAAATACTTGAAGG - Intergenic
997093138 5:130879675-130879697 ACATTTGAGCAAAAGCCTGAAGG + Intergenic
997113773 5:131103543-131103565 ATATTTATGCAGAAACTTGATGG - Intergenic
997214582 5:132100201-132100223 ACATCTGAGCAAAGACTTGAAGG - Intergenic
997221396 5:132168914-132168936 TCATTTGAGTAGAATCCTGAAGG - Intergenic
997281632 5:132651891-132651913 TTATTTGAGCAGAGACCTGAAGG - Intergenic
997836389 5:137196589-137196611 GCATTCGAGCTGAGACTTGAAGG - Intronic
997851343 5:137335593-137335615 GCAATTGAGCAGACACTTAATGG + Intronic
997899022 5:137746560-137746582 ACATTTGAGCAAAGACTTGAAGG - Intergenic
998193474 5:140045974-140045996 ACATTTAAGCTGAGACTAGAAGG + Intergenic
998373791 5:141678453-141678475 ACATTTGATCAAAAACTTGAAGG - Intronic
998599938 5:143575147-143575169 ACATTTGAACAGGGACCTGAAGG - Intergenic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
998801632 5:145874943-145874965 ACATTTGAGGTGTGACTTGAAGG - Intergenic
998847947 5:146329127-146329149 ACATTTGACCTGACACCTGAAGG + Intronic
998908167 5:146929041-146929063 ATATCTGAGCAAAGACTTGAAGG - Intronic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999280162 5:150359915-150359937 TCATTTGGGCAGAGACCTGAAGG + Intronic
999443702 5:151622034-151622056 ACTTTTGAGCTGAAATCTGAAGG - Intergenic
999555157 5:152733433-152733455 ACATATTAGCACAAAGTTGATGG + Intergenic
999649103 5:153748255-153748277 ACATTTGAATTGAAACCTGAAGG + Intronic
999657966 5:153829032-153829054 ACATTTGAGCTGACATTCGAAGG - Intergenic
999957703 5:156720373-156720395 ACATTTAAGCATACACCTGAAGG + Intronic
1000041080 5:157485771-157485793 ACATTTGAGCTGAGACATGAAGG - Intronic
1000262219 5:159598841-159598863 ACAGTTGAGCAAAGATTTGAAGG - Intergenic
1000359697 5:160435642-160435664 ACTTTTGAACAGAGATTTGAAGG + Intergenic
1000414169 5:160966033-160966055 AAATTTAAGCAGAAACTCAAAGG + Intergenic
1000858958 5:166433516-166433538 ACATTTAAGCTGAGACCTGAGGG - Intergenic
1000893976 5:166832740-166832762 GCATTTGAGCAAATTCTTGATGG + Intergenic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1000994021 5:167940859-167940881 ATATTTGATCAGAGACCTGAAGG - Intronic
1001004894 5:168041511-168041533 ACATTTGAGCAAAGACATAAAGG - Intronic
1001046280 5:168374422-168374444 AGATTTGAGCTAAGACTTGAAGG + Intronic
1001125316 5:169013751-169013773 ATATTTGAGCAGAGACCTGAAGG - Intronic
1001464061 5:171946672-171946694 CCATTTGAGCAAAGACTTGAAGG - Intronic
1001517808 5:172368189-172368211 CCACTTGAGCAGGAACCTGAAGG - Intronic
1001531162 5:172462891-172462913 ACATTTGAGTAAAGACTAGAAGG + Intergenic
1001675681 5:173512871-173512893 ACATTAGAACAGACACCTGAAGG - Intergenic
1001834752 5:174822552-174822574 ACATTTGAGCGGAAGCATGAAGG + Intergenic
1001887206 5:175303652-175303674 ACATTTAGGCAACAACTTGAAGG + Intergenic
1002028435 5:176411454-176411476 GCATTTGAGCAGAAGCTGAAGGG - Intronic
1002192370 5:177484969-177484991 GCATTCGAGCAGAAACTTGAAGG - Intronic
1002432859 5:179213199-179213221 ACATTTCAGCAGACACCTGAAGG - Intronic
1002732107 5:181346167-181346189 ACATTTAAGAATAGACTTGAAGG + Intergenic
1002752425 6:127938-127960 ACATTTAAGAATAGACTTGAAGG - Intergenic
1002783431 6:383898-383920 ACATTTGAGCAGAACTTTGATGG - Intergenic
1002891557 6:1337102-1337124 ACATTTGAGCTGAGATCTGAAGG - Intergenic
1002934987 6:1663766-1663788 ACATTTCAGCAGAGCCATGAAGG - Intronic
1003344922 6:5258004-5258026 ACAATTGAGCTCAATCTTGAAGG + Intronic
1003739432 6:8919206-8919228 ACATTTCAGCAGAGATCTGAAGG + Intergenic
1003827088 6:9964946-9964968 ACATTTTAGCAAAATCTTCAAGG - Intronic
1003935333 6:10970165-10970187 ACATTTGAGCTGAAGTCTGAAGG + Intronic
1004064364 6:12228503-12228525 ATATTTAAGCCGAAACCTGAAGG + Intergenic
1004207516 6:13606161-13606183 AGATTGGAGCAAAGACTTGAAGG + Intronic
1004222655 6:13759727-13759749 ACATTTGAGCAGAGACTTGAAGG - Intergenic
1004456449 6:15796216-15796238 GCAATTGGGCAGAGACTTGAGGG + Intergenic
1004735905 6:18406303-18406325 TTATTTGAGCAGAGACCTGAAGG + Intronic
1004739591 6:18445807-18445829 ACATTGGAATAGAAATTTGAAGG + Intronic
1005087195 6:22019263-22019285 AGACTTGAGCTGAAGCTTGAAGG - Intergenic
1005243663 6:23857762-23857784 ACATTTATGCATACACTTGAGGG + Intergenic
1005405876 6:25487345-25487367 ACATTTGGGCAGACCCTTCATGG - Intronic
1005463274 6:26088977-26088999 ACACTTGAGCAGAGACATGAAGG + Intronic
1005671929 6:28115036-28115058 ACATTTGAGGAGGAAATTGAGGG - Intergenic
1005687354 6:28267475-28267497 ATATTTGAGCAGAAATCTGAAGG + Intronic
1005758454 6:28946429-28946451 GCATCTGAACAGAGACTTGAAGG + Intergenic
1005964304 6:30716194-30716216 ACATTTGAACTGAATCTTAAAGG - Intronic
1006278496 6:33027068-33027090 TCATTTGACCATATACTTGAGGG + Intergenic
1006364361 6:33606656-33606678 ACATTTAAGCTGAGCCTTGAGGG + Intergenic
1006430835 6:33994788-33994810 ACATTTGTACAGAAATTAGAAGG + Intergenic
1006607067 6:35265607-35265629 ACATTTGAGCAAAGACCTGAAGG + Intronic
1006835474 6:36996348-36996370 ACATTTAAGCAAAGATTTGAAGG + Intergenic
1006869520 6:37238553-37238575 ACATATAAGCAGAAACCTGCTGG + Intronic
1006876825 6:37304990-37305012 ACATTTGAGCAGAGCCCTGAAGG + Intronic
1007153334 6:39717451-39717473 ACATTTGAGCAAAGACTTGATGG - Intronic
1007279805 6:40703065-40703087 ACATTTCAACAGAAATTTGGAGG - Intergenic
1007772757 6:44204317-44204339 ATATTTGAGCAAAGATTTGAAGG + Intergenic
1007835317 6:44669525-44669547 AGTTTTGAGCTGAACCTTGAAGG + Intergenic
1007895229 6:45348830-45348852 TCATTTAAGCTGAAACATGAAGG - Intronic
1008211041 6:48726452-48726474 ATATTTGTGCAGGAACTTGTTGG - Intergenic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1008440636 6:51528317-51528339 GCATTTGAGTTGAAACATGAAGG - Intergenic
1008523007 6:52380233-52380255 AGATTTGAGCAAAGACTGGAAGG + Intronic
1008928009 6:56907590-56907612 ACATAAGAGCAGAATGTTGAAGG - Intronic
1009025233 6:57991664-57991686 ACATTTAAACTGAAACCTGAGGG - Intergenic
1009444300 6:63722329-63722351 ACACTTGATCTGAAACCTGAAGG - Intronic
1009566226 6:65314173-65314195 ACATTTGAGAAAGTACTTGAAGG - Intronic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1009911260 6:69930941-69930963 TCATTTGAGGATAAACTTGAAGG + Intronic
1010099034 6:72080786-72080808 AAATTTGAGCAAAGACCTGAAGG - Intronic
1010131361 6:72497474-72497496 ACATTAGAGCTGAATCTTGAAGG - Intergenic
1010611333 6:77957330-77957352 ACATTTGAGAAGAGACTTGAAGG + Intergenic
1011440286 6:87380157-87380179 AGATTTGAACAAAGACTTGAAGG + Intronic
1011890154 6:92148683-92148705 ACACTGGAGCAGAAGCTTGAAGG - Intergenic
1011996137 6:93590405-93590427 GCATTTGAGCAAAGACCTGATGG - Intergenic
1012246954 6:96936909-96936931 ACATTTGAGCAAAGACCCGAAGG - Intronic
1012416214 6:99016825-99016847 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1012534860 6:100283327-100283349 AGATTTGAACTGAATCTTGAAGG + Intergenic
1012749168 6:103135682-103135704 GCACTTGAGCTGAGACTTGAAGG - Intergenic
1012782345 6:103578744-103578766 ATATTTGAGCTGGAATTTGAAGG + Intergenic
1012889491 6:104882478-104882500 ATATTTGAGCAGAAGCCTGAGGG - Intergenic
1013190655 6:107802334-107802356 ATGTTTGAGCAGAGACTTCAAGG + Intronic
1013334134 6:109137935-109137957 ACAATTGAGCAGAGACCTGAAGG + Intronic
1013370700 6:109468491-109468513 ACATGTGAACAGAGACTTGAAGG - Intronic
1013499020 6:110728810-110728832 ACATTTGTGCAGAGATTTGAAGG - Intronic
1013570220 6:111415707-111415729 ACATCTGAGCAAAGACCTGAAGG - Intronic
1013586676 6:111585064-111585086 ACATCTGAGCTGAAACCTAAAGG - Intronic
1013681102 6:112527202-112527224 ACATTTAAGAAGAATCTTCATGG - Intergenic
1013796390 6:113893945-113893967 ACAGTTGAACGGAAACTTTAAGG + Intergenic
1013923511 6:115439861-115439883 ACATTTGTGCACAGACTTGGAGG + Intergenic
1013941360 6:115667114-115667136 ACATTTGACATGAAACCTGAAGG + Intergenic
1014002913 6:116385009-116385031 ACATTTGAGCAAAAATTTAAAGG + Intronic
1014019156 6:116567802-116567824 ACCTTTGAGGAAAGACTTGAAGG + Intergenic
1014988837 6:128048478-128048500 ATGTTTCAGCAGAAACCTGAAGG - Intronic
1015405833 6:132835934-132835956 TCATCTGAGCAGAAATCTGAGGG - Intergenic
1015439528 6:133232193-133232215 ACATGTGAGATGAAACTTTAGGG - Intergenic
1015445197 6:133296066-133296088 ACATTTGAGCACAGGCCTGAAGG + Intronic
1015630521 6:135227732-135227754 CCATTTAAGCAGAAATTTTAAGG - Intergenic
1015656731 6:135526972-135526994 TCATTTGAGTAACAACTTGATGG - Intergenic
1015713546 6:136167100-136167122 AGATTTGAGCAAAAGCTTGAAGG - Intronic
1015810762 6:137159810-137159832 ACATTTGAGCAAAGACTTGAAGG - Intronic
1015812535 6:137175246-137175268 ATATTTGAGCAGAGACATGAAGG - Intergenic
1015823091 6:137283529-137283551 ACATGTGTGCAAAATCTTGAAGG - Intergenic
1015864234 6:137711566-137711588 CCATTTGAGCAAACACTTGAAGG + Intergenic
1015891317 6:137972369-137972391 ACATTTAAGCAAAGACTTGAAGG - Intergenic
1015945968 6:138501494-138501516 AGATTTGAGCAAAACCTTGAAGG + Intronic
1015989297 6:138919667-138919689 TCATTTGAGTGAAAACTTGAAGG - Intronic
1016011772 6:139144398-139144420 ACATTTGAGCTGAGTCTTGCAGG + Intronic
1016407352 6:143744553-143744575 ACCTTTGAGCAGAGACTTGTGGG + Intronic
1016548303 6:145248611-145248633 ACATTTGAGCAAAAACCCAAGGG + Intergenic
1016762321 6:147751171-147751193 ACATTTAAGAAAAAACCTGAAGG - Intergenic
1016768693 6:147824338-147824360 ACATTTAAGCCCAAACTTCATGG - Intergenic
1016905743 6:149149217-149149239 ACATTTGAGTAAAAATGTGAAGG + Intergenic
1017197790 6:151720784-151720806 ACATTTGAGCCAAGACATGAAGG + Intronic
1017317489 6:153048700-153048722 ACATTTCAGTAAATACTTGAAGG - Intronic
1017329776 6:153182914-153182936 ACATTTGAGCATTTATTTGAAGG + Intergenic
1017359897 6:153555523-153555545 AGATTTGAACTGAAACTGGAAGG - Intergenic
1017543436 6:155426534-155426556 ACATTTGAACAGAGACCTGAAGG + Intronic
1017935648 6:159002512-159002534 ACATTTGAGTAAAGACTTGAAGG + Intergenic
1018595606 6:165477282-165477304 ACATTTGAGGAAAAACCTAAGGG - Intronic
1019236359 6:170618480-170618502 ACATTTAAGAATAGACTTGAAGG + Intergenic
1019949916 7:4363046-4363068 ACATTTGGGCAAAAAATTGAAGG - Intergenic
1020202374 7:6089857-6089879 ATATTTCATCAGACACTTGAGGG - Intergenic
1020417704 7:7965277-7965299 ACATTTGAGTAAAGACCTGATGG + Intronic
1020432152 7:8125447-8125469 AGATCTGAGCAGAGACTTGCAGG - Intronic
1020661953 7:10994058-10994080 ATATTTGAGCAGTGACCTGAAGG + Intronic
1020820700 7:12963730-12963752 ATATTTGAGCAGAACCCTGAGGG - Intergenic
1020855824 7:13421484-13421506 ATATTTGAGTAGAAACCTAAAGG + Intergenic
1021056010 7:16047044-16047066 ACATTCGAACAAACACTTGAAGG + Intergenic
1021162838 7:17298224-17298246 AGATTTGAGTTGAGACTTGAAGG - Intergenic
1021209638 7:17831612-17831634 ACATTTGAGCCTAAAATTAAAGG - Intronic
1021770400 7:23995038-23995060 ACATTTGAGGTGAAGCATGACGG - Intergenic
1021988612 7:26120852-26120874 ACTTCTGAGCCAAAACTTGAAGG - Intergenic
1022656643 7:32325317-32325339 ACATTTGAGCAAAGACTCAAAGG - Intergenic
1022656653 7:32325411-32325433 ACATTTGAGCAAAGACTCAAAGG - Intergenic
1022900771 7:34808498-34808520 ACATTTCAGGAAAAACTTAAGGG - Intronic
1022909649 7:34888283-34888305 ATATTTAAGCAAAAACCTGAAGG + Intergenic
1022994999 7:35746379-35746401 ACATTTGAGCAGAGATTTCAAGG + Intergenic
1022995012 7:35746516-35746538 ACATTTGACCAAAAACCTGATGG + Intergenic
1023111296 7:36813533-36813555 ACCTTTAAGCAAAAACTTGAAGG - Intergenic
1023316253 7:38940424-38940446 ACAATAGAGCACAAAGTTGATGG - Intergenic
1023376043 7:39556571-39556593 ACATTTGAACAGAGACCTGAAGG + Intergenic
1023381918 7:39616722-39616744 TAATTTGAGCAGAAGCTAGAAGG + Intergenic
1023574987 7:41617974-41617996 TCATATGAGCAGAAACCTGAAGG + Intergenic
1023576137 7:41629242-41629264 ACATTTCATCTGAAAGTTGAGGG + Intergenic
1023781626 7:43661050-43661072 GCATTTGAGCTGAGACTTAAAGG - Intronic
1023840137 7:44092421-44092443 ACATTTGAGCAGTGACTTCATGG + Intergenic
1024283668 7:47739066-47739088 TCATTTGAGCAGAGACCTGAGGG - Intronic
1024310677 7:47966219-47966241 ACAATTGAGCCGACACCTGAAGG + Intronic
1024952537 7:54879704-54879726 ACATTTGAGCAGAACCTTAGAGG + Intergenic
1025183543 7:56838072-56838094 AAAATTGAGCAAAGACTTGAAGG - Intergenic
1025688383 7:63738895-63738917 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1025978153 7:66385887-66385909 AAAATTGAGCAAAGACTTGAAGG - Intronic
1026362694 7:69617364-69617386 ATATTTGAGCAGAAACTTGAAGG + Intronic
1026497257 7:70913960-70913982 AGACATGAGCAGAAACTGGAAGG + Intergenic
1026774029 7:73220231-73220253 ACATTTGAGCAGAGAAATGGAGG + Intergenic
1027014886 7:74773617-74773639 ACATTTGAGCAGAGAAATGGAGG + Intergenic
1027073145 7:75172336-75172358 ACATTTGAGCAGAGAAATGGAGG - Intergenic
1027304994 7:76884911-76884933 GCATTTGAACTGAAACCTGAAGG + Intergenic
1027488526 7:78792114-78792136 ACATTAGAGAAGAAACATGGGGG + Intronic
1027696459 7:81417060-81417082 ACATTTGAGCCAAAACCTGAAGG - Intergenic
1027846905 7:83391192-83391214 ACTTTTGAGCTTAATCTTGAAGG - Intronic
1028404082 7:90457314-90457336 GCATTTGAACAAAGACTTGAAGG + Intronic
1028515186 7:91670511-91670533 TCATTTGAGCTGGATCTTGAAGG - Intergenic
1028629182 7:92915058-92915080 AGATTTGAACAAACACTTGAAGG - Intergenic
1028889776 7:95974055-95974077 ACATGTGAGCAAAAACTTAATGG - Intronic
1029090234 7:98041999-98042021 ACATTTGGGAAGAAAGCTGAAGG - Intergenic
1029172149 7:98638725-98638747 ACATTTGATCCAAGACTTGACGG + Intergenic
1029337477 7:99914729-99914751 ACATTGCAGCTGAAACTTGCTGG - Intronic
1029545425 7:101207887-101207909 ACATCTTAGCTGAGACTTGAAGG - Intronic
1030116391 7:106065240-106065262 ACATCTGAGCTGAGACTTGAAGG + Intergenic
1030116931 7:106069111-106069133 ACATTTGGGCAGAAGCCTGAAGG + Intergenic
1030190292 7:106803934-106803956 GTATTTGAGCAAAAACTTGAAGG + Intergenic
1030220336 7:107091970-107091992 GCATTTGAGCAGAGATTTGAGGG + Intronic
1030309935 7:108058977-108058999 ATATTTGAGCAGAAGCTGGCAGG - Intronic
1030359055 7:108576247-108576269 AAATTTGAGCAGATGCTTGAAGG + Intergenic
1030554678 7:111008435-111008457 ACATTTGACCAGAGACTTGAAGG - Intronic
1031062328 7:117066029-117066051 ACATTTGGGCTGAAATCTGAAGG - Intronic
1031106785 7:117553825-117553847 ACATTTGAACAAAGACTTGCAGG + Intronic
1031116874 7:117678507-117678529 GCAATTGAGCAGAAACATGAAGG + Intronic
1031140575 7:117938352-117938374 ACTTTTGAGCTGAGCCTTGAGGG + Intergenic
1031503585 7:122553070-122553092 ACTTTTGAGATAAAACTTGAAGG - Intronic
1031513824 7:122678808-122678830 ACATTTTAGCAGAATGTTGCAGG + Intronic
1031539495 7:122976509-122976531 AGACTTGAGGAGAAATTTGAAGG - Intergenic
1031560508 7:123232365-123232387 ATATTTAGGCTGAAACTTGAAGG - Intergenic
1031673988 7:124586907-124586929 ACATTTGAACAAAGACTTCAAGG - Intergenic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1032175738 7:129624172-129624194 ATGTTTGAGCAGAGACCTGATGG - Intronic
1032180424 7:129672012-129672034 GCCTTTGAACAGAGACTTGAAGG + Intronic
1032317822 7:130856174-130856196 TTATTTGTGCAGAAACTTGCTGG + Intergenic
1032379859 7:131467478-131467500 GCATTTGAATAGAAACTTAAGGG + Intronic
1032446762 7:131990928-131990950 ACATTTGAGCAGAGACATAAAGG + Intergenic
1032663491 7:134011895-134011917 ACATTTGAGGAAAAACCTAAAGG + Intronic
1032787792 7:135214284-135214306 ACATTTGAGCAAATGCGTGAAGG - Intergenic
1033156946 7:138965168-138965190 AGATTTGAGCAGAGACCGGAAGG + Intronic
1033157212 7:138967368-138967390 AAATCTGAGCAGAGACCTGAAGG + Intronic
1033285155 7:140035141-140035163 GCAGTTGAGCATAAACTGGATGG + Intronic
1033440307 7:141372440-141372462 ACATTTGAGTAAAGACCTGAAGG - Intronic
1033663270 7:143418376-143418398 ACTTTTGAGCAAAGAATTGAAGG + Intergenic
1033889813 7:145997742-145997764 ACATATGAGAAGCCACTTGAGGG + Intergenic
1033984495 7:147207086-147207108 GCATTTCAGCAGAATTTTGAAGG - Intronic
1034024531 7:147685795-147685817 AAATTTGAACAGAAATTTGAAGG + Intronic
1034037066 7:147836049-147836071 ACAACTGACCACAAACTTGATGG - Intronic
1034147922 7:148888591-148888613 ACATATGAAGAAAAACTTGAAGG + Intergenic
1034313317 7:150109317-150109339 AAATGTAAGTAGAAACTTGAAGG + Intergenic
1034793546 7:153991347-153991369 AAATGTAAGTAGAAACTTGAAGG - Intronic
1034847344 7:154458612-154458634 ACAAATGACCACAAACTTGATGG - Intronic
1035511414 8:188117-188139 ACATTTAAGAATAGACTTGAAGG - Intergenic
1035981582 8:4378669-4378691 ACATTTGAGCAGGGACAGGAAGG - Intronic
1036547641 8:9787553-9787575 ATATTTGAGCTGGGACTTGAAGG - Intergenic
1036941422 8:13056292-13056314 ACATCTGAGCAGAGCCCTGATGG + Intergenic
1037156345 8:15704154-15704176 TCATTTAAGCAGAGACCTGAAGG + Intronic
1037362266 8:18085649-18085671 AAGTTTGAGCAGACAGTTGAGGG + Intergenic
1037516624 8:19638209-19638231 ACATTTGAGCTGAGACCTGAAGG - Intronic
1037586341 8:20279111-20279133 ACATTTGAGCTGGACCTTGAAGG - Intronic
1038191150 8:25322360-25322382 ACATCTTAGCTGAGACTTGAAGG + Intronic
1038526535 8:28278973-28278995 ACATTGGAGCAGGGACCTGAAGG - Intergenic
1038529877 8:28309860-28309882 AGATTTGAGCAGGGTCTTGAAGG - Intergenic
1038567812 8:28634501-28634523 GCACTTCAGCAGAATCTTGAAGG - Intronic
1038869905 8:31482342-31482364 ACATTTGAGCTGAAACTTGAAGG + Intergenic
1038914843 8:32009630-32009652 ACCTTTGAGCAAAATCGTGAAGG + Intronic
1039029483 8:33294095-33294117 ACATTTCAGCATCAACTTCAAGG + Intergenic
1039117301 8:34105986-34106008 ACATATAAGCAGAAATATGAAGG + Intergenic
1039137256 8:34339180-34339202 AAAATTGAGAAGAAACTTGAAGG + Intergenic
1039207147 8:35169769-35169791 ACACCTGAGCTGAACCTTGAAGG - Intergenic
1039329145 8:36517511-36517533 ACATTTGAGCAGAAGCATTAAGG + Intergenic
1039654250 8:39382141-39382163 ACAGTATAGCTGAAACTTGAGGG - Intergenic
1039706216 8:40010217-40010239 ACATTTGAGCAGACACCTGGAGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040889893 8:52306162-52306184 ACATTTGAGTAAAGATTTGAAGG - Intronic
1041183193 8:55270364-55270386 GCATTTGAGATGACACTTGAAGG - Intronic
1041232299 8:55766188-55766210 ATTTTTCAGCAGAAACCTGAGGG + Intronic
1041452672 8:58023641-58023663 ACATGTGAGCAGCAGCTAGATGG - Intronic
1041756714 8:61321835-61321857 ACAGCAGAGCAAAAACTTGAAGG - Intronic
1042357600 8:67846243-67846265 ACATTTGAACAGAAAGCTGATGG - Intergenic
1042502166 8:69521467-69521489 AGATTTGAACAAAGACTTGAAGG + Intronic
1042521677 8:69718969-69718991 CCATTTGAGCAAAAACCTGAAGG + Intronic
1042689279 8:71479284-71479306 CAATTTGAGCAAAATCTTGAAGG - Intronic
1043247513 8:78023757-78023779 ACATTTAAACTGAGACTTGAGGG + Intergenic
1043268737 8:78301565-78301587 ACAGCTGAGCAGAGTCTTGAAGG + Intergenic
1043379445 8:79686955-79686977 ACATTTGAGGAGAGTCTTGAAGG + Intergenic
1043553667 8:81404448-81404470 ACATTTAAGCAGAAACCAGAGGG + Intergenic
1043820933 8:84863235-84863257 ACATTTGAGTGGAAACCTAAAGG + Intronic
1043962634 8:86434466-86434488 ACATTTGAGCAAAAACATGAAGG - Intronic
1043962774 8:86436366-86436388 ACATTTAAACAGAAACATAAAGG - Intronic
1044026446 8:87178340-87178362 ACATTTGAGCAGAAACATGAAGG + Intronic
1044251629 8:90009298-90009320 ACATTGGAGCAAAGACGTGAAGG - Intronic
1044294337 8:90510267-90510289 ATATTTGAGTAGAGACTTAAAGG - Intergenic
1044425700 8:92047299-92047321 ACTTTTGAGCAGAGATTTGAGGG - Intronic
1044506703 8:93028783-93028805 AAATTTGAGCAAAGATTTGAGGG - Intergenic
1044730004 8:95221934-95221956 ACATTTGAGCAGAGACTGAAGGG + Intergenic
1045285660 8:100789186-100789208 ACACTTGAGCAAAGTCTTGAAGG + Intergenic
1045375633 8:101571239-101571261 GCATTTGAGCTGCATCTTGAAGG + Intronic
1045707024 8:104936126-104936148 ACATTTCAGCAGAGAAGTGAAGG + Intronic
1046321403 8:112581891-112581913 ACATTTGAGTAGAGACCTGAAGG + Intronic
1046353280 8:113044958-113044980 ACATTTGAGCTGAATATTTAAGG - Intronic
1046563251 8:115866225-115866247 ACATTTGAGCAGAGCCTTGAAGG + Intergenic
1046738787 8:117806655-117806677 AGATTTGAGCAGAGACTTGAAGG - Intronic
1046739517 8:117813351-117813373 ACATTTAAGCAGGACCCTGATGG + Intronic
1046771042 8:118116646-118116668 GCATCTGAGGAGAGACTTGAAGG - Intergenic
1046810232 8:118525248-118525270 ACATTTAATCAGAGACCTGAAGG - Intronic
1046950460 8:120015279-120015301 ACATTTAATCTGAGACTTGAAGG - Intronic
1046960948 8:120112344-120112366 AGTATTGAGCAGGAACTTGAAGG + Intronic
1046994595 8:120503516-120503538 ACATTTGAGCTGAGACCTAACGG + Intronic
1047615891 8:126562280-126562302 AGAAATGAGCAGAGACTTGAAGG + Intergenic
1047664524 8:127076123-127076145 ACATTTCAGCAGATATTTGAAGG - Intergenic
1047673176 8:127171263-127171285 ACGTTTGAACTGAGACTTGAAGG - Intergenic
1048067533 8:130985284-130985306 ACATTTGAGCTGAGTTTTGAAGG + Intronic
1048136822 8:131754336-131754358 ACATTTGAACAGAATTTTAAAGG - Intergenic
1048220759 8:132539410-132539432 ACATTTGAACTGATACTTGAAGG + Intergenic
1048228532 8:132614227-132614249 ACATCTGAGCAGAGGCCTGAAGG + Intronic
1048290909 8:133181147-133181169 AAGTCTGAGCAGAATCTTGAAGG + Intergenic
1048358948 8:133678684-133678706 GCATTTGAGCAGAACCTTCAAGG - Intergenic
1048455061 8:134570190-134570212 ACATTTGAACAGAGACTTGAGGG - Intronic
1048459209 8:134606016-134606038 ACATTTGAGCAGAAAGCTGAAGG + Intronic
1049251928 8:141593895-141593917 AGCTCTGAGCAGAAACGTGAAGG + Intergenic
1049845718 8:144799968-144799990 ACATTTGAACTGAAACCTGCTGG + Intronic
1049994191 9:1019007-1019029 ACATTTAAGCACAGACTTGAAGG + Intergenic
1050027052 9:1346364-1346386 ATATTTGATCAAATACTTGAAGG - Intergenic
1050154080 9:2647374-2647396 AAATTTGAGCAGAAAACTCAAGG - Intronic
1050229480 9:3505674-3505696 ACATTTGAACAAAGACCTGAAGG - Intronic
1050263382 9:3864595-3864617 ACATTTGAAAAGAAACTGGCCGG + Intronic
1050322233 9:4464852-4464874 ACATTTGAGTTTAAACCTGATGG + Intergenic
1050376913 9:4984031-4984053 ACATTTGAGCAGAGATCTGAAGG - Intergenic
1050416344 9:5421298-5421320 ACCTTTGAGCAGAGCCTTGAGGG - Intronic
1050444160 9:5701030-5701052 AATTTTGAGAAGAAACATGAAGG - Intronic
1050668216 9:7966020-7966042 TCATTTGAGTAAAGACTTGAAGG - Intergenic
1050731535 9:8714688-8714710 ACATTTAAGCAAAGATTTGAAGG - Intronic
1050778816 9:9304345-9304367 ACATTTGAGCAAAGACTTAAAGG + Intronic
1050785037 9:9390038-9390060 ACATTTCAGCAGAGACTTCAAGG + Intronic
1050797812 9:9567143-9567165 GCATTTGAGCTGAAATTTGAAGG + Intronic
1050858402 9:10391950-10391972 CCATTTGAGCAGAAACCTGAAGG - Intronic
1050998700 9:12253054-12253076 ACATTTGAGTAAAAATCTGAAGG + Intergenic
1051688246 9:19681281-19681303 ATATTTGAGCAAAGACTTGAAGG - Intronic
1051781874 9:20697581-20697603 ACATTTGAACAGACACCTGAAGG - Intronic
1052025685 9:23571028-23571050 GCATTTGAGCTGAATGTTGAAGG - Intergenic
1052152398 9:25133202-25133224 ATATTTGACTAGAAACCTGAAGG - Intergenic
1052323047 9:27188979-27189001 ATATTTGAGCAAAGACTTGAAGG + Intronic
1052385489 9:27818972-27818994 TACTTTGAGCACAAACTTGAAGG + Intergenic
1052397060 9:27950824-27950846 AGATTTGGGCATAAACCTGATGG + Intronic
1052646878 9:31247612-31247634 ATATTTCAGCAGAGACTTTAAGG - Intergenic
1052953587 9:34233788-34233810 ACATTTGAGCAAAAACTTGAAGG + Intronic
1053005974 9:34604898-34604920 ACATTTTAGCAAAGACTTAAAGG + Intergenic
1053236813 9:36462617-36462639 ACATTTGAGCAGAAATTCGAAGG - Intronic
1053287324 9:36858499-36858521 TCATTTGGGCAGAAACTGGGGGG - Intronic
1053337620 9:37289939-37289961 ACATTTAAGCAACAACTTAAAGG - Intronic
1053341717 9:37341732-37341754 ACATTTGAGCCAAGGCTTGAAGG + Intronic
1053390060 9:37728401-37728423 ACATTTGGACTGAAACTCGAAGG + Intronic
1053544035 9:39004133-39004155 ACATTTGAGCTGAGACCTGCAGG - Intergenic
1053656025 9:40219036-40219058 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1053906372 9:42848238-42848260 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1054352394 9:64029066-64029088 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1054368131 9:64365260-64365282 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1054454577 9:65423280-65423302 ACATTCAAGGAGAAACTCGAGGG - Intergenic
1054528589 9:66157259-66157281 AAAATTGAGCAAAGACTTGAAGG - Intergenic
1054675752 9:67855003-67855025 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1054865738 9:69999221-69999243 ACATTTGAGCTGCCAATTGAAGG + Intergenic
1054887472 9:70214280-70214302 ACATCTGAGCAAAGACTTAAAGG + Intronic
1054986419 9:71267183-71267205 ACATTTAAGCTGAGCCTTGAAGG - Intronic
1054993101 9:71353137-71353159 AAATTTAAGCAGTAACCTGAAGG - Intronic
1055127114 9:72731615-72731637 ATTTTTGAGCAGGAAATTGATGG - Intronic
1055287550 9:74745575-74745597 AAATTTGAGCACAGAGTTGAAGG + Intronic
1055367020 9:75555534-75555556 ACATTTAAGCTGAATCTTAAAGG + Intergenic
1056234401 9:84577883-84577905 ATATTTGAACAAAAACTTGAAGG + Intergenic
1056436393 9:86579048-86579070 GCATTAGAGCAGAAGCTTGAAGG - Intergenic
1056438516 9:86596928-86596950 ACAAATTACCAGAAACTTGAGGG + Intergenic
1057066467 9:92056693-92056715 CCATTGGAGCAGAAACTTAGAGG - Intronic
1057334421 9:94144555-94144577 GCATTTGAGCTGAGGCTTGAAGG - Intergenic
1057372959 9:94490612-94490634 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1058007637 9:99935770-99935792 ACATTTGAGCAGAGATCTAAAGG + Intronic
1058250303 9:102686496-102686518 TCAAATTAGCAGAAACTTGAGGG + Intergenic
1058392298 9:104509580-104509602 CCCTTTGAGCAGAATCTTTAGGG + Intergenic
1058416584 9:104795162-104795184 ACATTTTAGCTAAATCTTGAAGG + Intronic
1058428488 9:104897325-104897347 ACATCTGATCAGACACTTCAAGG + Intronic
1058516033 9:105776908-105776930 GCATTTTAGCAGAGACCTGAAGG + Intergenic
1058800112 9:108537569-108537591 ACATCTGAGCTGCATCTTGAAGG + Intergenic
1059108827 9:111535363-111535385 GCATTTGAGTTGAATCTTGAAGG + Intronic
1059286110 9:113172991-113173013 ACATTTGAGCAGAGCCAAGAAGG - Intronic
1059310704 9:113387270-113387292 ACATTTGAGCCTAGACCTGAAGG - Exonic
1059611183 9:115898359-115898381 ACATTTGAATAAAGACTTGAAGG + Intergenic
1059643654 9:116242253-116242275 ACATGTAAGCTGAGACTTGAAGG + Intronic
1059647334 9:116280373-116280395 ACATTTAAGCTGAGACTTGAGGG + Intronic
1059658680 9:116379819-116379841 ACATTTGAGCTAGATCTTGAAGG + Intronic
1059823968 9:118006104-118006126 ATATCTGAGCTGAAGCTTGAAGG - Intergenic
1059847286 9:118294323-118294345 ACATTTGGGCAAAATCTTGAAGG - Intergenic
1059930345 9:119254363-119254385 ACATTTGAGGAGACACCTGAAGG + Intronic
1060066752 9:120508709-120508731 GGATTTGAGCTGAGACTTGAAGG - Intronic
1060116923 9:120949087-120949109 AAATTTGAGCAAAGACTTGAAGG - Intergenic
1060468026 9:123924938-123924960 ACATTTGAGCTGAGACTTAAAGG - Intronic
1061265872 9:129504750-129504772 GCATTTGAGCAGTGCCTTGAAGG - Intergenic
1061476648 9:130871955-130871977 ACAGCTGACCAGCAACTTGATGG - Intronic
1061904315 9:133688785-133688807 ACATTTGGGCAGAACCCTGCAGG - Intronic
1062756507 9:138298502-138298524 ACATTTAAGAATAGACTTGAAGG + Intergenic
1203553001 Un_KI270743v1:179968-179990 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1186341814 X:8653574-8653596 ACACTTGAGCAGAAATCTGGAGG - Intronic
1186367207 X:8907963-8907985 ATATTTAAGCAAACACTTGAAGG - Intergenic
1186785069 X:12949502-12949524 AAATTTGAGCTGAGATTTGAGGG - Intergenic
1186931689 X:14398299-14398321 ACATTTAAGCAGAAATCAGAAGG - Intergenic
1186954021 X:14660237-14660259 ATATTTGAGCAAAGACTTGATGG + Intronic
1186998844 X:15154156-15154178 ACAGATGACCAGAAAATTGAGGG + Intergenic
1187328197 X:18311508-18311530 ACATGTGAGCAGAAATCTGAAGG + Intronic
1187598917 X:20805295-20805317 TCATTTGAGCAGAAAATAAAAGG + Intergenic
1188412077 X:29885209-29885231 ACATTTGAGAAAAAACTTGGAGG - Intronic
1188539314 X:31232005-31232027 ACATTGAAGCAAAGACTTGAAGG + Intronic
1188616394 X:32164020-32164042 ACATTTGAACAGAAATCTCAAGG - Intronic
1188701550 X:33270602-33270624 ACACTTGAGAAGAAACTAGACGG + Intronic
1189074007 X:37897026-37897048 ACATTTGAACAAACATTTGAAGG + Intronic
1189091049 X:38083206-38083228 ACATTTGATCAGAATTTTAATGG + Intronic
1189226969 X:39421191-39421213 ACATTTGAGGTGAACCATGAAGG + Intergenic
1189670529 X:43403832-43403854 GCATTTGAGCAGAGACATGAAGG + Intergenic
1189969449 X:46403054-46403076 ACATTTGAGCAGAAACCTTAAGG - Intergenic
1190014189 X:46812712-46812734 TCATTTGAGCAGAAACCTAAGGG - Intergenic
1190112819 X:47605784-47605806 ACATTTGAGGAAAGACCTGATGG - Intronic
1190573100 X:51804817-51804839 ATATTTGAGCAGGAACCTGAAGG + Intronic
1190738357 X:53270489-53270511 GTATTTGAGCAGAGGCTTGAAGG - Intronic
1190855202 X:54287422-54287444 ACATTTGAGCAGACACTTGAAGG - Intronic
1190937625 X:55010629-55010651 AAACTTGAGCAAAAATTTGAAGG - Intronic
1190950228 X:55136292-55136314 ACATTTGAACTTCAACTTGAAGG + Intronic
1191045127 X:56128030-56128052 GAATTTGAGCAGAATTTTGAAGG + Intergenic
1191199317 X:57762346-57762368 ACTTTTGAGTAGAAACTACATGG - Intergenic
1191666042 X:63703830-63703852 ATATTTGAGCAAAGACTTGAAGG + Intronic
1191718617 X:64210396-64210418 ACATTTGAGCAGCCACCTGAAGG - Intergenic
1191882827 X:65859679-65859701 ACATTTGAGCAGAACCTCAAAGG - Intergenic
1191896310 X:65997192-65997214 AGATTTGAACTGAAACTTGAAGG - Intergenic
1191976807 X:66881810-66881832 ACATTTGAGCAAATAACTGAAGG + Intergenic
1192111063 X:68365238-68365260 ACATTTGAGCAGAGACTTAAAGG + Intronic
1192185323 X:68942845-68942867 ATATTTGAGCAAAGACTTTAAGG + Intergenic
1192316021 X:70052523-70052545 GCATTTGAGCAAAGGCTTGAAGG + Intergenic
1192334097 X:70203085-70203107 ACATTTGAGCAAAGACTTGAAGG - Intronic
1192370526 X:70509028-70509050 ACATTTGAGCTGGAGCTTGAAGG - Intergenic
1192595925 X:72408336-72408358 ACAACTGAGCAAAGACTTGAAGG + Intronic
1192608122 X:72541223-72541245 TTATTTGAGCAAAGACTTGAAGG + Intronic
1194188965 X:90810868-90810890 ATATTTGAGTAAAGACTTGAAGG + Intergenic
1194298494 X:92156379-92156401 ACATTTAAGCAAAGATTTGAAGG - Intronic
1194423585 X:93708172-93708194 ACATTTAAGCTGAAACCTGAAGG + Intronic
1194724002 X:97373575-97373597 ACATTCAAGCAGAGACTTAAGGG + Intronic
1194819193 X:98485340-98485362 ATATTTGATCAAAGACTTGAAGG + Intergenic
1194936198 X:99951875-99951897 ACATTTAAGCTAAAACCTGAAGG + Intergenic
1194974549 X:100380305-100380327 ATATTTGAGCTGACCCTTGAAGG - Intronic
1195005002 X:100677156-100677178 ACATTTGAGCCAAGACCTGAAGG + Intronic
1195572988 X:106417306-106417328 GCATTTGAGCAGAGACTTGAAGG + Intergenic
1195624904 X:106997823-106997845 ACATTTAAGCTGAGATTTGAAGG - Intronic
1195679344 X:107532260-107532282 ACATTTGAAGAAAGACTTGAAGG + Intronic
1195679926 X:107537550-107537572 ACACCGGAGCAGAATCTTGAAGG + Intronic
1195691169 X:107626818-107626840 ACATTTGGGCAAAGACCTGAAGG - Intergenic
1195742046 X:108074718-108074740 CTATTTGAGCAGGATCTTGAAGG + Intronic
1195814748 X:108872819-108872841 ACATTTAAGCTGAAAATTGAAGG + Intergenic
1195980241 X:110569555-110569577 ATATTTGAGCAGAGATTTGAAGG + Intergenic
1196177194 X:112652103-112652125 AGATTTAAGAAGAAACCTGAAGG - Intronic
1196232649 X:113241770-113241792 ACATTTGAGCTGAGATATGATGG + Intergenic
1196237655 X:113300849-113300871 ACATTGGAGCAGAATCTTGAAGG - Intergenic
1196676028 X:118420769-118420791 ATATTTGAGCTGAATCTTGAAGG - Intronic
1196694843 X:118600732-118600754 ACATTTGAGCAGAGACCTAAAGG + Intronic
1196707591 X:118728939-118728961 GCATTTGAGTAGAGACCTGAGGG + Intronic
1196715643 X:118808362-118808384 ACATTTAAGCTGAAATTTTAAGG + Intergenic
1196921135 X:120586418-120586440 ACATTTGAGCAAAGACTTGAAGG + Intergenic
1197048314 X:122027417-122027439 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1197204732 X:123779972-123779994 ACACTTCAGCAAAAACTTAAAGG + Intergenic
1197214632 X:123856623-123856645 ACAATTAAGCAAAGACTTGAAGG + Intergenic
1197308247 X:124870533-124870555 ACATTTAAGCAAAAGCTTGATGG + Intronic
1197326572 X:125101838-125101860 ACATTTGAGCAGAGTTTTAATGG - Intergenic
1197329038 X:125131014-125131036 ACATTTCAGCAGAGACTTGAAGG + Intergenic
1197609918 X:128626609-128626631 AGATTTGAGCAAAGACCTGAAGG + Intergenic
1197673677 X:129307318-129307340 ACATATAAGCTGAGACTTGAAGG + Intergenic
1197694688 X:129538532-129538554 ACATTTGAGCAAAGACCTGAAGG + Intergenic
1197814712 X:130485284-130485306 ACAATTGAGCTGAGACATGAAGG - Intergenic
1197845334 X:130795850-130795872 ACATTTGAGCCGAGTTTTGAAGG - Intronic
1198185453 X:134249996-134250018 ACATTTGAGCTGGGCCTTGAAGG + Intergenic
1198427109 X:136531274-136531296 ACACTTCAGCAGAACCCTGAGGG - Intergenic
1198505170 X:137294289-137294311 TCATTTGAGCAGATATGTGAGGG - Intergenic
1198732849 X:139752127-139752149 ACATTTGGGCAGAGACCTGGAGG - Intronic
1198747873 X:139908289-139908311 ACATTTAAGCAGATAACTGAAGG - Intronic
1198797811 X:140417577-140417599 AACTTTGAGCAGAACCTTGAAGG - Intergenic
1199496203 X:148455359-148455381 ACATGTGAGCATAAAATTCAGGG + Intergenic
1199518925 X:148713021-148713043 ACATTTGAACAAAGACTTGAAGG + Intronic
1199572337 X:149279553-149279575 ACATTTGAGTAAAGACTTAAAGG + Intergenic
1199907244 X:152245721-152245743 ATATTTGAGAAAAGACTTGAAGG - Intronic
1199937546 X:152590363-152590385 ACATTGGAAAAGAAACTTGAAGG + Intergenic
1200098346 X:153674516-153674538 ACATTTGAGCCGAGATCTGATGG - Intronic
1200179036 X:154139251-154139273 ACATGTGAGCAAAGACTCGAGGG - Intergenic
1200535546 Y:4392769-4392791 ATATTTGAGTAAAGACTTGAAGG + Intergenic
1200616104 Y:5381340-5381362 ACATTTAAGCAAAGATTTGAAGG - Intronic
1201154280 Y:11115623-11115645 AAAATTGAGCAAAGACTTGAAGG + Intergenic
1201223785 Y:11796650-11796672 ATCTTTGAGCAGAATCTTTAGGG + Intergenic
1201426614 Y:13858388-13858410 ACATTCAAGCAAAAGCTTGATGG + Intergenic
1201887498 Y:18901654-18901676 ATATTTGAACAGAAACCTGGGGG + Intergenic
1202383631 Y:24301511-24301533 ACATTTAAGAATAGACTTGAAGG + Intergenic
1202487152 Y:25368609-25368631 ACATTTAAGAATAGACTTGAAGG - Intergenic