ID: 907384147

View in Genome Browser
Species Human (GRCh38)
Location 1:54115014-54115036
Sequence GCTCACAAAACTATTCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907384147_907384156 29 Left 907384147 1:54115014-54115036 CCATGGGGAATAGTTTTGTGAGC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384147_907384151 10 Left 907384147 1:54115014-54115036 CCATGGGGAATAGTTTTGTGAGC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 907384151 1:54115047-54115069 TCCATGTTAACCCCAGAGTCAGG No data
907384147_907384157 30 Left 907384147 1:54115014-54115036 CCATGGGGAATAGTTTTGTGAGC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 907384157 1:54115067-54115089 AGGCTGTTCCCAGAGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907384147 Original CRISPR GCTCACAAAACTATTCCCCA TGG (reversed) Intergenic
905901377 1:41583972-41583994 GCTCCTCAAACTCTTCCCCAGGG + Exonic
906867830 1:49441591-49441613 CCTCACAAATCTATTTCTCAAGG - Intronic
906879433 1:49574549-49574571 CCTCACAAATCTATTTCACAAGG - Intronic
907384147 1:54115014-54115036 GCTCACAAAACTATTCCCCATGG - Intergenic
908825558 1:68129636-68129658 GTTCACACACCCATTCCCCAAGG - Intronic
910790164 1:91042501-91042523 CCTCACAAATCTATTTCACAAGG - Intergenic
911767696 1:101699090-101699112 GCTCACAACACTATAGTCCATGG + Intergenic
911945549 1:104103185-104103207 GCTTATAAAAATATTTCCCAAGG - Intergenic
912130158 1:106589973-106589995 CCTCACAAATCTATTTCACAAGG + Intergenic
912733577 1:112130750-112130772 CCTCACAAATCTATTTCTCAAGG + Intergenic
912944071 1:114070098-114070120 CCTCACAAATCTATTTCACAAGG + Intergenic
914711569 1:150218988-150219010 CCTCACTAAACTTATCCCCAAGG + Exonic
915194469 1:154179179-154179201 GCTCACAAATGCATTACCCAGGG + Intronic
915756531 1:158266675-158266697 GTTCATAAAAATATTCCCCCAGG + Intergenic
916106592 1:161437215-161437237 CCTCACAAATCTATTTCACAAGG + Intergenic
916729848 1:167556145-167556167 GCTCACACACCTGTTGCCCACGG - Intergenic
917306023 1:173626321-173626343 GAGCACTAAACTATTCCACAGGG + Intronic
917929100 1:179811704-179811726 GCTCACAAAGCTATGCACCCTGG - Intronic
918500024 1:185183861-185183883 GCTCTCAAAAACATTCTCCATGG + Intronic
918755971 1:188339714-188339736 CCTCACAAATCTATTTCACAAGG + Intergenic
1064517905 10:16170158-16170180 CCTCACAAATCTATTTCACAAGG + Intergenic
1064545902 10:16449726-16449748 TCTCACAAATCTATTTCACAAGG + Intronic
1068158803 10:53236998-53237020 ACTCAAAAAACTAATCCTCAGGG - Intergenic
1068446959 10:57136665-57136687 CCTCACAAATCTATTGCACAAGG - Intergenic
1069901606 10:71709649-71709671 GCTCACAAAACCAGTCCACTGGG + Intronic
1072209519 10:93233611-93233633 CCTCACAAATCTATTTCACAAGG + Intergenic
1075525869 10:123186294-123186316 GCTTCCAAAACTATTTCCCTGGG - Intergenic
1076401214 10:130186649-130186671 GCTCAGAAAATGATACCCCAAGG - Intergenic
1077123702 11:922961-922983 GGTCACAGTACTATTCCCAAGGG - Intergenic
1080020010 11:27550555-27550577 GCACACAAAACTACTGTCCATGG - Intergenic
1080197680 11:29631261-29631283 TATGACAAAACTATACCCCACGG - Intergenic
1086894331 11:92294536-92294558 GCTCACAAATCACTTCCCAATGG - Intergenic
1086912568 11:92489932-92489954 GCTCAGAAAACTAGTCTGCAGGG + Intronic
1087262010 11:96022194-96022216 GCTCATAACAGTATTCCCAAGGG + Intronic
1087351148 11:97034304-97034326 TATTATAAAACTATTCCCCATGG + Intergenic
1088191932 11:107236442-107236464 CCTCACAAAACTATTTCACAAGG + Intergenic
1089023041 11:115238131-115238153 GCTACCAAATCTATACCCCATGG - Intronic
1089903371 11:122011687-122011709 CCTCACAAATCTATTTCGCAAGG - Intergenic
1092381030 12:7997254-7997276 CCTCACAAATCTATTTCACACGG - Intergenic
1092976878 12:13753739-13753761 GCCCACAAAGCTATTCTCAATGG + Exonic
1093036043 12:14333399-14333421 CCTCACAAATCTATTTCGCAAGG - Intergenic
1094017270 12:25878633-25878655 GGTCAGAAAACTATAACCCATGG + Intergenic
1096548681 12:52358290-52358312 GATCAAAGAACTATTCCCCTCGG - Intergenic
1098426304 12:70367933-70367955 TCTCAGAAAACTGTTCCCAATGG + Intronic
1099526133 12:83721206-83721228 CCTCACAAATCTATTTCCCAAGG - Intergenic
1099859648 12:88210562-88210584 CCTCACAAATCTATTTCACAAGG + Intergenic
1100049969 12:90435991-90436013 CTTCACAAAACTATTTCACAAGG - Intergenic
1100241422 12:92713631-92713653 CCTCACAAATCTATTTCACAAGG + Intergenic
1101575349 12:105992213-105992235 TCTCATAAAACCATTTCCCAGGG - Intergenic
1102359859 12:112276010-112276032 GCTCACAAATCTGCTCCACATGG + Intronic
1102820602 12:115906092-115906114 GCTCACAAAAAAATGCCCTAAGG + Intergenic
1106002408 13:25736740-25736762 GATCAAAAAACTATTGCCCCGGG - Intronic
1109642309 13:65206541-65206563 GCTGATAAAACTATTCTTCAAGG + Intergenic
1111540548 13:89662073-89662095 GCTCAGAAAATGATACCCCAAGG - Intergenic
1112231385 13:97592098-97592120 CCTCACAAATCTATTTCACAAGG + Intergenic
1112697826 13:101970465-101970487 GCTCAGAAAACAATACCCCAAGG + Intronic
1117216575 14:53558166-53558188 CCTCACAAATCTATTTCGCAAGG - Intergenic
1118355442 14:65009805-65009827 GGTCAGAAAACTCTTCCCAAAGG - Intronic
1119246967 14:73118608-73118630 TCTGACAAAACTACTTCCCAAGG - Intronic
1119440932 14:74628288-74628310 CCTCACACAACATTTCCCCAGGG + Intergenic
1120556249 14:85932380-85932402 CCTCACAAATCTATTTCCCAAGG + Intergenic
1124989204 15:34654094-34654116 GTTCACAAAAGTATTCTACAAGG - Intergenic
1125747341 15:42005905-42005927 TCCCACAAAGCCATTCCCCAGGG - Intronic
1131044792 15:89305428-89305450 AATGACAAAGCTATTCCCCATGG - Intronic
1133185169 16:4090896-4090918 AATCACAAAACTATTCCGAATGG + Intronic
1133461988 16:5994739-5994761 GCTCATCAAACTACTGCCCATGG - Intergenic
1134368309 16:13599840-13599862 GCTCACAAAAATAGTCCCTGGGG + Intergenic
1135035258 16:19071817-19071839 GGTCACAAATCAGTTCCCCATGG - Intronic
1141329041 16:83091134-83091156 GATCACTAAAATATTTCCCAGGG - Intronic
1143734708 17:8902684-8902706 GCTGCCAAACATATTCCCCAGGG - Intronic
1144368381 17:14567229-14567251 GGTCAAAAAAGTTTTCCCCATGG - Intergenic
1144424011 17:15124042-15124064 GCTCAAAAGACTAGTCCTCAAGG - Intergenic
1146307847 17:31744382-31744404 GCTCACAAAACTAAACACAATGG + Intergenic
1146618292 17:34374290-34374312 ACCCACAAAAGTATTTCCCAGGG + Intergenic
1148060484 17:44832626-44832648 GCTCAGAAAATGATTTCCCAGGG + Intergenic
1148821905 17:50364713-50364735 CCTCACAAATCTCTGCCCCAGGG + Intergenic
1149077130 17:52608689-52608711 GATCACAGAGCTATTACCCATGG - Intergenic
1154363265 18:13682945-13682967 CCTCAAAACATTATTCCCCATGG - Intronic
1155440967 18:25862330-25862352 GCTCACAACCCTATTCACTAAGG + Intergenic
1156192301 18:34733653-34733675 CCTCACAAATCTATTTCACAAGG + Intronic
1156351916 18:36309260-36309282 GCTCACAACGCTCTTCCCCTCGG - Intronic
1156782705 18:40870306-40870328 TCTTACAAGCCTATTCCCCATGG - Intergenic
1156990539 18:43402642-43402664 CCTCACAAATCTATTTCACAAGG + Intergenic
1157147913 18:45184531-45184553 GCCCACAAAATAATTCCACATGG + Intergenic
1160448335 18:78944327-78944349 GTTTACAAAACCAATCCCCAGGG - Intergenic
1165527609 19:36369300-36369322 GCTCAGGAAACTAATGCCCAGGG + Intronic
925398555 2:3555013-3555035 GTTCCCAAAACTAACCCCCAAGG + Intronic
926457859 2:13090866-13090888 GCTCACAAAAAAAATCCACAAGG - Intergenic
928100266 2:28432803-28432825 ACTGACAAAACTATTAACCATGG - Intergenic
928594472 2:32846845-32846867 GCTCACATAACCAGTCTCCAAGG + Intergenic
930584433 2:53252809-53252831 GCTCACAAACTTATTCTCCATGG - Intergenic
932306918 2:70710424-70710446 GCTCACACCGCTATGCCCCAGGG + Intronic
932745828 2:74332827-74332849 GCTTACAAAACTAAACCACAGGG - Intronic
937701498 2:124867641-124867663 TCTCTCAAAACTCTACCCCAAGG + Intronic
937790170 2:125952041-125952063 ACTCACCAAACAATTCCCTAGGG + Intergenic
937851822 2:126642922-126642944 GCTCAGAAAATAATACCCCAAGG + Intergenic
940606172 2:155926315-155926337 CCTCACAAATCTATTTCACAAGG + Intergenic
941667750 2:168259237-168259259 CCTCACAAATCTATTTCACAAGG - Intergenic
943517852 2:188909182-188909204 CCTCACAAATCTATTTCGCAAGG + Intergenic
946166242 2:217865780-217865802 ACTCACAAGACTATCCCTCAGGG - Intronic
946528120 2:220541907-220541929 CCTCACAAATCTATTTCACAAGG + Intergenic
948737545 2:240019071-240019093 GCTCAGAGCACTAGTCCCCAGGG + Intronic
1168797074 20:618071-618093 GCTCACAAAACTCTGCTCCAGGG + Intergenic
1169873405 20:10271047-10271069 CCACTCAAAACTATTCCCCGAGG - Intronic
1170642498 20:18166946-18166968 GCCCAGAAGATTATTCCCCAGGG - Intronic
1173984773 20:47252499-47252521 ACTCACAAAAATACTCTCCATGG + Intronic
1175244901 20:57576207-57576229 GCTCAGAAAAAGTTTCCCCATGG + Intergenic
1176736139 21:10548480-10548502 GCTCACAGAAGTAGTCCCCAGGG + Intronic
1177807108 21:25885272-25885294 GCTCACCAATCTCTTCCTCATGG + Intronic
1178328734 21:31666978-31667000 GCTAACAAAGCTATGTCCCAAGG - Intronic
1182073965 22:27482264-27482286 GGTCCCCAAACTATTCCCCACGG + Intergenic
949270426 3:2210050-2210072 TCTTACAAAACTATTTACCAAGG + Intronic
951122346 3:18943626-18943648 CCTCACAAATCTATTTCACAAGG - Intergenic
951603996 3:24411472-24411494 GCTCACAAAAATTAACCCCAGGG - Intronic
953897650 3:46814442-46814464 CCTCACAAACCTATTTCACAAGG + Intergenic
954053864 3:48005755-48005777 CCTCACAAATCTATTTCACAAGG - Intronic
954588848 3:51762684-51762706 GCCCACAAATCTATGCCCCCTGG - Intergenic
956509390 3:69978409-69978431 CCTCACAAATCTATTTCACAAGG - Intergenic
957354441 3:79063212-79063234 GGTCAGAAAACTATACCTCAAGG - Intronic
960349316 3:116574047-116574069 CCTCACAAATCTATTTCACAAGG - Intronic
960955787 3:123029518-123029540 GATGACAAAAACATTCCCCATGG - Intergenic
961741980 3:129038847-129038869 GCTCAGCAAAATCTTCCCCAGGG - Exonic
964440724 3:156706326-156706348 GTTCACAAAAGAATTCGCCATGG + Exonic
965191073 3:165530503-165530525 CCTCACAAATCTATTTCACAAGG + Intergenic
966423098 3:179753344-179753366 GCTCACAAAACTATTCTGCCAGG - Intronic
966445431 3:179996617-179996639 CCTCACAAATCTATTTCACAAGG - Intronic
967831519 3:193924041-193924063 CCTCACAAATCTATTTCACAAGG - Intergenic
969067491 4:4498598-4498620 TATCACAAAACTATTCTCCTTGG - Intronic
972031585 4:34465934-34465956 GGTCAGCAAACTATACCCCATGG + Intergenic
972201539 4:36719091-36719113 CCTCACAAATCTATTTCACAAGG + Intergenic
976322770 4:83734400-83734422 GCTCAGAAAATGATACCCCAAGG + Intergenic
977204445 4:94153676-94153698 CCTCACAAATCTATTTCACAGGG - Intergenic
978217977 4:106230053-106230075 GCTCACAAAAAGCTTCACCATGG - Intronic
978341908 4:107728209-107728231 CCTCACAAATCTATTTCACAAGG + Intergenic
980388164 4:132113054-132113076 CCTCACAAATCTATTTCTCAAGG + Intergenic
982835260 4:160114623-160114645 CCTCACAAATCTATTTCACAAGG - Intergenic
983771395 4:171554052-171554074 TCTCACAAAATTATAACCCAAGG + Intergenic
984061319 4:174991752-174991774 CCTCACAAATCTATTTCACAAGG + Intergenic
986033154 5:3911808-3911830 GCTGTCAAAACTATTACCCTGGG - Intergenic
986474109 5:8108064-8108086 GATAACAACACAATTCCCCATGG - Intergenic
986955785 5:13148081-13148103 CCTCACAAATCTATTTCACAAGG + Intergenic
987022813 5:13892283-13892305 GCTGAAAAAAATAGTCCCCAAGG + Intronic
987526656 5:19059428-19059450 AATTAAAAAACTATTCCCCATGG + Intergenic
987621575 5:20342960-20342982 CCTCACAAATCTATTCTGCAAGG - Intronic
987933276 5:24429754-24429776 GCTCACAAAACAATACTCCAAGG - Intergenic
988169438 5:27634763-27634785 CCTCACAAATCTATTTCACAAGG + Intergenic
989047644 5:37288328-37288350 GATCTCAAAAGTATTCCTCAGGG - Exonic
989457904 5:41663719-41663741 CCTCACAAATCTATTTCGCAAGG + Intergenic
993232148 5:85249487-85249509 CCTCACAAATCTATTTCACAAGG + Intergenic
994958215 5:106562390-106562412 CCTCACAAATCTATTTCACAAGG - Intergenic
995001321 5:107133892-107133914 ACTCTCAAAAATATCCCCCAAGG + Intergenic
995745989 5:115404121-115404143 GCTCAAAGAAATATTCCCCCAGG - Intergenic
996353265 5:122569304-122569326 ATTCACAAAACAATTCCACAGGG + Intergenic
999411675 5:151355505-151355527 GCTCACACACGTATACCCCAGGG + Intergenic
1000185333 5:158852203-158852225 GCTGAAAAAGCTATTCCCCAAGG + Intronic
1000416715 5:160991976-160991998 CCTCACAAATCTATTTCACAAGG - Intergenic
1000488910 5:161884653-161884675 GCACACATAACTTTTCCTCAAGG + Intronic
1000730534 5:164829014-164829036 CCTCACAAATCTATTTCACAAGG - Intergenic
1003454675 6:6270827-6270849 GCTCACACAACTCTTATCCACGG - Intronic
1003696153 6:8408045-8408067 CCTCACAAATCTATTTCGCAAGG + Intergenic
1003719257 6:8682108-8682130 GCTCAAAGAACTTTACCCCATGG + Intergenic
1003880658 6:10476947-10476969 TCTCACAGAACTGTTCACCAGGG + Intergenic
1006062092 6:31431212-31431234 CCTCACAAACCTATTTCACAAGG - Intergenic
1007819487 6:44550528-44550550 TCTCCCAAAACAAGTCCCCACGG + Intergenic
1007911101 6:45514762-45514784 GCTCCCAGGACTAGTCCCCAGGG - Intronic
1008318498 6:50077338-50077360 GCTCTCAAAATAATTACCCAGGG - Intergenic
1008400037 6:51053540-51053562 CCTCACAAATCTATTTCACAAGG - Intergenic
1009828547 6:68899238-68899260 GCTGTCAAAACTATTTCCAAAGG - Intronic
1010818341 6:80386139-80386161 TCTCACAAATCTATTGCACAAGG - Intergenic
1012006560 6:93720038-93720060 GGTCACATAAAAATTCCCCATGG - Intergenic
1014245111 6:119059520-119059542 TCTAACAAAACCATTTCCCAGGG + Intronic
1014506688 6:122268246-122268268 TCTCTCAAAAGTTTTCCCCATGG + Intergenic
1014631411 6:123794865-123794887 CCTCACAAATCTATTTCACAAGG - Intergenic
1014701381 6:124693126-124693148 GCTCATAAATGTACTCCCCAAGG - Intronic
1015467182 6:133560179-133560201 CCTCACAAATCTATTTCACAGGG + Intergenic
1016576501 6:145574542-145574564 CCTCACAAATCTATTTCACAAGG + Intronic
1016757713 6:147704826-147704848 GCTCACTCAGCTAATCCCCAAGG - Intronic
1016880209 6:148904119-148904141 GAACACAAAACTCTTCACCAAGG + Intronic
1018055836 6:160051530-160051552 GCTCAGAAAGCAATACCCCAAGG - Intronic
1018081045 6:160259580-160259602 GCTCAGAAATCCATGCCCCAAGG + Intronic
1018496948 6:164358455-164358477 GCTCACAAAAGTATTTCCCTTGG - Intergenic
1028141490 7:87280029-87280051 CCTCACAAATCTATTTCACAAGG - Intergenic
1028982204 7:96979672-96979694 ACACACAAAAAAATTCCCCAGGG + Intergenic
1033544305 7:142386084-142386106 GCCCACCAGACTATTCCCTAGGG + Intergenic
1034686846 7:152979451-152979473 GCTCACAAAAATATTATACATGG - Intergenic
1037274296 8:17160891-17160913 GCTCAGCAAACTTTTGCCCAAGG - Intronic
1039777880 8:40754604-40754626 CCTCACCAAACTATACCCCCAGG - Intronic
1040607847 8:48952121-48952143 GCTCAAGAAACTAGTCCCCAAGG - Intergenic
1040848463 8:51872324-51872346 GCTAACAAAATTAATCCTCAGGG + Intronic
1041985930 8:63922534-63922556 CCTCACAAATCTATTTCACAAGG - Intergenic
1042757048 8:72226368-72226390 GCTGGCAAAAATATTACCCAAGG - Intergenic
1048006384 8:130422605-130422627 GCTCCCAAAACTCTCTCCCATGG + Intronic
1048837151 8:138530869-138530891 GCTCACAATTCTGTTCCTCAAGG + Intergenic
1050482408 9:6100662-6100684 CCTCACAAATCTATTTCACAAGG - Intergenic
1050876737 9:10648678-10648700 GCTGAAATAACTATTTCCCAAGG + Intergenic
1055572819 9:77633682-77633704 GCTCACCAAAATCTACCCCATGG - Intronic
1058172851 9:101703752-101703774 GCCCCCAAAACAATTCCACAAGG - Intronic
1059351704 9:113670005-113670027 GCTCATACAACCATCCCCCAAGG - Intergenic
1059661686 9:116407870-116407892 GCTCACAGAATTCGTCCCCAGGG - Intergenic
1060716345 9:125933436-125933458 GCTCACATCACTTTTGCCCAGGG - Intronic
1061527146 9:131175471-131175493 GCTAGCAAAATTATTCCTCAAGG + Exonic
1187424891 X:19168187-19168209 TCTTACAAAATTATTCCCCTTGG - Intergenic
1191631093 X:63322956-63322978 CCTCACAAATCTATTTCACAAGG - Intergenic
1191742775 X:64453253-64453275 CCTCACAAATCTATTTCACAAGG + Intergenic
1191769747 X:64742049-64742071 CCTCACAAATCTATTTCACAAGG + Intergenic
1193683818 X:84553332-84553354 GCTCTCAAAACTTTCCACCAAGG - Intergenic
1193841652 X:86414558-86414580 CCTCACAAATCTATTTCACAAGG + Intronic
1193877031 X:86873351-86873373 CCTCACAAATCTATTTCACAAGG - Intergenic
1194809445 X:98372753-98372775 TCCCACAAAACTAGTCCACAAGG - Intergenic
1194849511 X:98854121-98854143 CCTCACAAATCTATTTCACAAGG + Intergenic
1194972961 X:100364285-100364307 GCTCACACTACCATTCCTCAGGG + Intronic
1195782620 X:108481820-108481842 CCTCACAAATCTATTTCACAAGG + Intronic
1195800493 X:108703308-108703330 GCACAGAAAACTACTCCCCATGG + Intergenic
1195809912 X:108817778-108817800 CCTCACAAATCTATTGCACAAGG + Intergenic
1197002041 X:121451001-121451023 CCTCACAAATCTATTTCACAAGG - Intergenic
1197074293 X:122336849-122336871 CCTCACAAACCTATTTCACAAGG + Intergenic
1197468527 X:126837521-126837543 GTTCACACAAGCATTCCCCAAGG - Intergenic
1197477615 X:126943278-126943300 CCTCACAAATCTATTTCGCAAGG + Intergenic
1197563141 X:128048319-128048341 GCTCACTCACCTTTTCCCCATGG + Intergenic
1198417722 X:136437108-136437130 GCACACAGCACTATTCACCAAGG - Intergenic
1200340547 X:155391038-155391060 ACTCACAAATCTATTTCTCAAGG + Intergenic
1200973307 Y:9179499-9179521 CCTCACAAATCTATTTCACAAGG + Intergenic
1202137769 Y:21685013-21685035 CCTCACAAATCTATTTCACAAGG - Intergenic