ID: 907384149

View in Genome Browser
Species Human (GRCh38)
Location 1:54115039-54115061
Sequence TGGGGTTAACATGGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907384149_907384156 4 Left 907384149 1:54115039-54115061 CCCTTCTCTCCATGTTAACCCCA No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384149_907384157 5 Left 907384149 1:54115039-54115061 CCCTTCTCTCCATGTTAACCCCA No data
Right 907384157 1:54115067-54115089 AGGCTGTTCCCAGAGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907384149 Original CRISPR TGGGGTTAACATGGAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr