ID: 907384152

View in Genome Browser
Species Human (GRCh38)
Location 1:54115048-54115070
Sequence GCCTGACTCTGGGGTTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907384152_907384160 29 Left 907384152 1:54115048-54115070 CCATGTTAACCCCAGAGTCAGGC No data
Right 907384160 1:54115100-54115122 TGCAGCACAATTTATCTCCCTGG No data
907384152_907384156 -5 Left 907384152 1:54115048-54115070 CCATGTTAACCCCAGAGTCAGGC No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384152_907384157 -4 Left 907384152 1:54115048-54115070 CCATGTTAACCCCAGAGTCAGGC No data
Right 907384157 1:54115067-54115089 AGGCTGTTCCCAGAGTGCAAGGG No data
907384152_907384161 30 Left 907384152 1:54115048-54115070 CCATGTTAACCCCAGAGTCAGGC No data
Right 907384161 1:54115101-54115123 GCAGCACAATTTATCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907384152 Original CRISPR GCCTGACTCTGGGGTTAACA TGG (reversed) Intergenic
No off target data available for this crispr