ID: 907384156

View in Genome Browser
Species Human (GRCh38)
Location 1:54115066-54115088
Sequence CAGGCTGTTCCCAGAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907384149_907384156 4 Left 907384149 1:54115039-54115061 CCCTTCTCTCCATGTTAACCCCA No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384148_907384156 5 Left 907384148 1:54115038-54115060 CCCCTTCTCTCCATGTTAACCCC No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384152_907384156 -5 Left 907384152 1:54115048-54115070 CCATGTTAACCCCAGAGTCAGGC No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384150_907384156 3 Left 907384150 1:54115040-54115062 CCTTCTCTCCATGTTAACCCCAG No data
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data
907384147_907384156 29 Left 907384147 1:54115014-54115036 CCATGGGGAATAGTTTTGTGAGC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907384156 Original CRISPR CAGGCTGTTCCCAGAGTGCA AGG Intergenic
No off target data available for this crispr