ID: 907386824

View in Genome Browser
Species Human (GRCh38)
Location 1:54131194-54131216
Sequence ATTCCTACCTGCAAGGCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907386824_907386827 9 Left 907386824 1:54131194-54131216 CCAAACGCCTTGCAGGTAGGAAT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 907386827 1:54131226-54131248 CGTGTGTGCTGCTGTGTGCCTGG 0: 1
1: 0
2: 3
3: 60
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907386824 Original CRISPR ATTCCTACCTGCAAGGCGTT TGG (reversed) Intergenic
901306277 1:8235279-8235301 ATTCCTGCCTGCAGGGGGTTTGG + Intergenic
902540101 1:17148521-17148543 ATTTCTAGCTGCAGGGCCTTGGG + Intergenic
902701291 1:18174267-18174289 ATTCCTTCCTGCAACGCCTCGGG - Intronic
903392870 1:22977011-22977033 ACTCCTCCCTGCAAGGAGGTGGG - Intergenic
906033191 1:42736023-42736045 ATTCATACCTGCAAGGGGTAGGG + Exonic
907386824 1:54131194-54131216 ATTCCTACCTGCAAGGCGTTTGG - Intergenic
908172427 1:61519140-61519162 ATTCCTACCAGCAAGGCATAAGG + Intergenic
909765127 1:79346092-79346114 ATTCCTAACTGCTAGGTTTTTGG - Intergenic
910925671 1:92395981-92396003 ATTCCCACCAGCAATGCATTAGG - Exonic
911132595 1:94405243-94405265 ATTCCTACCAGCAATGCATGAGG + Intergenic
911733659 1:101314759-101314781 ATACCTAGCTGCAAGGTGTATGG - Intergenic
913129334 1:115825685-115825707 ATACCAACATGCAAGGCTTTTGG - Intergenic
914251233 1:145923466-145923488 ATTCCTAGATACAAGGCATTTGG - Intergenic
916610260 1:166384941-166384963 TTTCCTACCTGCAAGGTGGCTGG + Intergenic
918410240 1:184250869-184250891 ATTCCTACCTCCAAAGTGTCTGG + Intergenic
923270481 1:232351118-232351140 ATTCCTACCAGCAGTGCGTTAGG - Intergenic
1064164551 10:12974952-12974974 ATTCCTACCTCGCAGGGGTTAGG - Intronic
1064541609 10:16411562-16411584 GTGCCTACCTGCAAGGGATTTGG - Intergenic
1066417926 10:35238397-35238419 ATTCCTACCAGCCAGGCTTCCGG - Intergenic
1068024502 10:51626413-51626435 AATCCTACCTGCATGTTGTTAGG + Intronic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1070215384 10:74373688-74373710 ATTCCCACCAGCAATGCCTTAGG - Intronic
1073909553 10:108325666-108325688 ATTCCTACCCTCGAGGAGTTTGG - Intergenic
1076155275 10:128200130-128200152 ATTCATACCTGCAGGGCAGTAGG - Intergenic
1076639581 10:131905069-131905091 ACTCCTACCTGCAGGGGGATGGG - Intronic
1079590221 11:22174583-22174605 GTTCTGACCTGCAAGGAGTTGGG + Intergenic
1080952127 11:37046138-37046160 ATCCCTAATTGCAAGGAGTTTGG + Intergenic
1081419499 11:42856874-42856896 AATCCTACCTGCAGAGAGTTAGG - Intergenic
1082902307 11:58268079-58268101 ATTTCTACCTGCCAAGAGTTGGG + Exonic
1089867984 11:121648655-121648677 ATCCCTTCCTGCAAGGAGTCTGG + Intergenic
1090219515 11:125006172-125006194 ATTCCCACCAGCAAGGAGTGAGG + Intronic
1091597502 12:1888052-1888074 CTTCCCACCTTCAAGGCTTTGGG - Intronic
1092914324 12:13176098-13176120 ATTTCTAGCTGCAGGGCCTTGGG - Intergenic
1093184405 12:16003363-16003385 ATTCTTACATGCTAGGGGTTAGG + Intronic
1094530224 12:31267501-31267523 ATTCCTACCAGCAATGCATTAGG + Intergenic
1104560121 12:129835758-129835780 ACTCATCCCTGCAAGGCATTGGG - Intronic
1107705235 13:43096607-43096629 ATTCCTAACAGCAAGGTCTTTGG - Intronic
1111371958 13:87331452-87331474 ATTCTTACCAACAAGGCCTTGGG - Intergenic
1112980319 13:105376417-105376439 AACCCTATCTGCAAGGCATTTGG - Intergenic
1113639621 13:111947957-111947979 ATTCACACCTGCCAGGCCTTGGG - Intergenic
1117089403 14:52235236-52235258 ATGCCTAACTGCAAGGGGGTAGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119344042 14:73907148-73907170 TTTCCTACCTGCATGATGTTGGG - Intronic
1120128416 14:80775234-80775256 TTTCCTACCTGCGTGGCTTTAGG - Intronic
1120515435 14:85464774-85464796 ATTCCTTCCTCCTAGGCTTTAGG - Intergenic
1121486374 14:94319341-94319363 ATTCCTACCAGCAATGCATAAGG - Intronic
1124577705 15:30924441-30924463 ATTCCCACCAGCAATGCGTGAGG + Intronic
1125935549 15:43632355-43632377 ATTCCTCCCTGCAGGTCGTTTGG - Exonic
1128838470 15:70830398-70830420 CTTCCTACGTGCTAGGCATTGGG - Exonic
1129749471 15:78050931-78050953 ATTCCTAGCTGGAAGGAGTCTGG - Intronic
1134590108 16:15445669-15445691 ATTCCTACCAGCAAGGCATGAGG - Intronic
1135160244 16:20088046-20088068 CTTACTAACTGCAAGGAGTTTGG + Intergenic
1138379951 16:56593009-56593031 ATTCCTACCAGCAAGGCACAAGG - Intergenic
1138858699 16:60728242-60728264 ATTCCTACTTGTATGGCCTTGGG + Intergenic
1143978962 17:10851453-10851475 ATTCCTAGCTTCAATGGGTTGGG + Intergenic
1146401210 17:32501426-32501448 ATTCCTTCCTCCAAGGTGTTGGG - Intronic
1148626304 17:49071856-49071878 TTTCCTACCAGCAATGCGTGAGG + Intergenic
1152275043 17:79351365-79351387 ATTCCTATCTGCAAGGAGCAAGG + Intronic
1167527699 19:49995212-49995234 ATCCCTACCTGCATGGGTTTCGG - Exonic
928786070 2:34887750-34887772 AGTCCTGCCTTCAAGGCGTTGGG + Intergenic
929633178 2:43487610-43487632 ATTCTAACCTCCAAGGAGTTAGG + Intronic
929845526 2:45521536-45521558 ATTCCTACCAGCAATGCATGAGG - Intronic
930199596 2:48540412-48540434 ATTCCTTCCTCCAGGGCATTGGG - Intronic
933032345 2:77345682-77345704 ATTCCCACCTGCAATGCATGAGG - Intronic
935625094 2:105165755-105165777 ATTCCTACCAGCAATGCGCAAGG + Intergenic
936542921 2:113366593-113366615 CTTCCTAACTGCATGGCTTTGGG - Intergenic
939286739 2:140141024-140141046 ATTCCTGCCTCCATGGCTTTGGG - Intergenic
1170896678 20:20421350-20421372 ATTCCTACCAGCAAGGTATGAGG - Intronic
1173174501 20:40754301-40754323 CTTCCTTCCTTCAAGGCATTGGG + Intergenic
1173975684 20:47184815-47184837 TCTCCTCCCTGCCAGGCGTTTGG - Intronic
1175070432 20:56328879-56328901 ATTCCCACCAGCAAGGCATGAGG + Intergenic
1178104793 21:29305814-29305836 ATTCCTACATGTTAGGCATTTGG + Intronic
1181579478 22:23819763-23819785 ATTCCTACCAGCAAGGCGCAGGG + Intronic
955233542 3:57120503-57120525 ATTCCTAACTGCCAGGCCATAGG + Intronic
960292792 3:115906688-115906710 ATTGCTATCTACAAAGCGTTTGG + Intronic
961174958 3:124827609-124827631 ATTCCTACCAGCAGGGCGTGAGG - Intronic
964779264 3:160317148-160317170 ATCCCTACTTGCCAGGCATTGGG - Intronic
969266575 4:6067920-6067942 ACTGCTAACTGCAAGGCCTTTGG + Intronic
974852823 4:67424274-67424296 ATTCCTACCAGTAAAGCGTAAGG - Intergenic
977922059 4:102656460-102656482 ATTTCTACCAGCAAGGGATTAGG - Intronic
978171020 4:105670238-105670260 ATTCCTACCAGCAAAGTGTGAGG + Intronic
979669183 4:123344362-123344384 CTTCCTACCTGCAAGCCATGTGG - Intergenic
980661867 4:135871338-135871360 GTTCCTACCTGCAGGACTTTGGG + Intergenic
982465219 4:155722178-155722200 ATTACTACCTGTAAGTTGTTGGG - Exonic
983074721 4:163311969-163311991 ATTCCTACCAGCAATGCATGAGG - Intergenic
984957464 4:185059798-185059820 ATTCCTACCAGCAATGTGTGAGG + Intergenic
989419838 5:41224857-41224879 ATTTCTACCAGCAAGGTATTAGG + Intronic
992613422 5:78527236-78527258 TTTCCTGTCTCCAAGGCGTTTGG - Intronic
998884590 5:146680813-146680835 TTTTCTACCTGAAAGGTGTTAGG - Intronic
1000199163 5:158990269-158990291 GTTCCTACCAGGAAGGCCTTGGG + Intronic
1002070373 5:176675835-176675857 ATTCCCACCAGCAGGGCGTGAGG + Intergenic
1002882591 6:1266034-1266056 TCTCCTACCTGCAAGACGATTGG - Intergenic
1003003438 6:2358866-2358888 ATTCCTACCAGCAATGCGTAAGG + Intergenic
1003750912 6:9054850-9054872 ATTTATACCTGCAAGCAGTTGGG + Intergenic
1004359618 6:14959584-14959606 ATTCCTACCAGCAATGCATAAGG - Intergenic
1006780728 6:36630669-36630691 ATGCCTGCCTGCAAGGCGCCTGG - Intergenic
1006886847 6:37389090-37389112 ATTCCTGCCCTCAAGGAGTTCGG - Intronic
1008584307 6:52935002-52935024 ATTCCTACCTGCAGGCTGTATGG - Intergenic
1013182148 6:107726787-107726809 ATTCCTACCAGCAGGGTGTGGGG - Intronic
1019228238 6:170533229-170533251 ATTACTGCCTGCAAGGGGATTGG - Intergenic
1019949157 7:4357160-4357182 ATTCCCACCAGCAATGCGTGAGG + Intergenic
1020382615 7:7563592-7563614 ATTGCTACCTGCAAGGATCTTGG + Intergenic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1024447726 7:49501064-49501086 AATTCTACCTGCAAGGGATTTGG + Intergenic
1029851268 7:103463781-103463803 ATTCCTACCAGCAAGGTATGAGG + Intergenic
1032858239 7:135854656-135854678 ATCCCTATCTGCAAGGTTTTAGG + Intergenic
1034128782 7:148698128-148698150 CTTACCACCTGCAAGGCCTTAGG - Intronic
1035234979 7:157490723-157490745 ATTCCCACCAGCAAGGCGTGAGG + Intergenic
1036451087 8:8868167-8868189 ATTCCTTGCTGCAAGGCCTCTGG + Intronic
1038348865 8:26758172-26758194 ATTCCTACATTCAAGGTGCTAGG - Intronic
1040685223 8:49863789-49863811 CTTCATACCTGCAACTCGTTTGG + Intergenic
1042885289 8:73542815-73542837 ATTCCTACCAGCAATGTGTGAGG - Intronic
1045252583 8:100494189-100494211 ATTCTTCCCAGCAAGGCCTTGGG - Intergenic
1045470952 8:102511659-102511681 ATTCCTTGCTGGAAGGCCTTGGG - Intergenic
1047999848 8:130369753-130369775 ATTCCTACCAGCAATGTGGTGGG - Intronic
1048664795 8:136648970-136648992 TTTGCTACCAGCATGGCGTTTGG - Intergenic
1051985369 9:23079071-23079093 ATTCTTCCCTGGAAGGCTTTTGG + Intergenic
1053876954 9:42554502-42554524 ATTCCCACATGCCAGGCATTAGG - Intergenic
1054234744 9:62547220-62547242 ATTCCCACATGCCAGGCATTAGG + Intergenic
1056982619 9:91329364-91329386 ATTCCTACCAGCAATGCATGAGG + Intronic
1060770517 9:126328351-126328373 ATTCCTTCCTTCTAGGCTTTAGG + Intronic
1061598989 9:131653660-131653682 ATTCCTACCAGCAATGTGTAGGG - Intronic
1189082334 X:37988012-37988034 ATTCATAAGTGCAAGGGGTTAGG - Intronic
1189503738 X:41590050-41590072 ATTCCTTCCTAGAAGGAGTTGGG - Intronic
1192240269 X:69322925-69322947 ATTCCTTCCTGCAAGGACTTGGG + Intergenic
1195740423 X:108059651-108059673 ACTCCTACATACAAGGCCTTGGG - Intronic
1196733781 X:118966835-118966857 ATTCCCACCAGCAATGCGTAAGG - Intergenic
1202047420 Y:20748917-20748939 ATTCCTACCAGCAATGCGCAAGG + Intergenic