ID: 907389590

View in Genome Browser
Species Human (GRCh38)
Location 1:54149583-54149605
Sequence GTTTTCAGGTGTAAATCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907389590 Original CRISPR GTTTTCAGGTGTAAATCAGG TGG (reversed) Intronic
903781993 1:25826627-25826649 GTTTCCAGGTGTGCCTCAGGGGG - Exonic
906187027 1:43870156-43870178 GTCTTCATCTGTAAATTAGGGGG + Intronic
907389590 1:54149583-54149605 GTTTTCAGGTGTAAATCAGGTGG - Intronic
909284962 1:73804324-73804346 CTTTTCAGGTGTCACTGAGGGGG - Intergenic
912000713 1:104831661-104831683 ATTTACAGGTGTAATGCAGGGGG - Intergenic
915729128 1:158040659-158040681 GTTTTCAGGTGAAAATGGAGGGG + Intronic
916508767 1:165452809-165452831 GTATTCAGGTGTAGATTTGGAGG + Intergenic
916740556 1:167643754-167643776 GTTGTGAGGTGTAAATGAGTCGG + Intronic
918085323 1:181240063-181240085 CTTTTCAGGTGAAAATGAGAAGG + Intergenic
919662058 1:200256974-200256996 GTTTCCAGGTGTAAATTCAGTGG - Intergenic
920545827 1:206817190-206817212 GGTCTCATGTGCAAATCAGGGGG - Intronic
921898749 1:220428387-220428409 CTTTTCAGGTGGAAATTGGGGGG + Intergenic
922441804 1:225661995-225662017 GTTTTCTTGTCTAACTCAGGTGG + Intergenic
924613334 1:245591660-245591682 GTTCTCAGGTGTGAATGAAGTGG - Intronic
1063225081 10:4007985-4008007 GTTTTCAGGATTAAATAAGGTGG - Intergenic
1071120646 10:82273210-82273232 GTATACAGGTGAAGATCAGGAGG - Intronic
1076308471 10:129483395-129483417 GTTTTCAGGTGTAAAAAAAATGG - Intronic
1083008279 11:59368966-59368988 GTTTTGAGGTGTGATTCAGTAGG - Intergenic
1083834812 11:65259371-65259393 GATTGCAGGAGTAAATCAAGTGG - Intergenic
1086835327 11:91613849-91613871 GTTTTCAGCTGTTAAGCATGTGG + Intergenic
1086908214 11:92441625-92441647 GTTTTTAGTTTTAAATCAGTGGG - Intronic
1088810941 11:113391685-113391707 GGTTTCAGGGGAAAATCAGGAGG + Intronic
1089714746 11:120347879-120347901 ATTTTCAGGTGACAATGAGGTGG + Intronic
1090379160 11:126313136-126313158 GTTTCCCCGTGTAAACCAGGAGG + Intronic
1090863186 11:130672709-130672731 GCTCTCATGTGAAAATCAGGGGG - Intergenic
1091298810 11:134491967-134491989 GCTTTCACATGTAAATCAGAAGG - Intergenic
1093863782 12:24200003-24200025 GTTTTAAAGTGTAAAACTGGGGG + Intergenic
1094593798 12:31845614-31845636 GCTTTCAGGTGCAATACAGGAGG + Intergenic
1095179850 12:39134790-39134812 GTTTTGAGGCCTAAATCATGGGG + Intergenic
1096783741 12:54005516-54005538 GTTTTATGGTTTAAATAAGGTGG + Intronic
1097576087 12:61394348-61394370 ATTTTCAAGTGTCAATCAGCAGG + Intergenic
1099737661 12:86590781-86590803 GCTTTCAGGTGTAAAGCAGGAGG - Intronic
1100080504 12:90843299-90843321 GTTTTAAGGTTTAAATCATATGG + Intergenic
1103837089 12:123830350-123830372 GTTTTCCGGTTTAACTCTGGAGG + Intronic
1106481656 13:30141513-30141535 CTCTTCAGGTGAAAATGAGGGGG - Intergenic
1106652459 13:31706171-31706193 GGGTGCAGGTGGAAATCAGGTGG - Intergenic
1113001897 13:105648847-105648869 GTTTTCAAGTGAAAATCAGAAGG + Intergenic
1115711904 14:36059954-36059976 GTTTCCAAGTGTAAATAAGAGGG + Intergenic
1119187867 14:72656631-72656653 GTTTTCAGGCATAGACCAGGAGG - Intronic
1119957286 14:78812364-78812386 GTTTTCAGAAGGAAATAAGGTGG + Intronic
1120076531 14:80165586-80165608 GTTTTCACCTGTGAAACAGGAGG + Intergenic
1122310779 14:100792730-100792752 GTTTTCTGGAGAAAGTCAGGGGG + Intergenic
1123626500 15:22230324-22230346 GTTTTCAGGGGTACAACAAGTGG + Intergenic
1125143412 15:36437164-36437186 GTTTTAAGGAGAAAAGCAGGGGG + Intergenic
1129949345 15:79572219-79572241 GTCTTCACTTGTAAAGCAGGTGG - Intergenic
1133858133 16:9568797-9568819 GTTTCCAGGGGTAAAGCAGTAGG + Intergenic
1134537384 16:15037086-15037108 GTTTTCAGATTTTAACCAGGTGG - Exonic
1139201124 16:64978165-64978187 GTTTTTGAGTGTAAAACAGGAGG - Intronic
1143213936 17:5210060-5210082 GCTTCTAGGTGTAAATCAGAAGG + Exonic
1147470426 17:40653710-40653732 GTTTTCAAGTGTAAAACTTGAGG + Intergenic
1151060792 17:71091392-71091414 TTTTTCACCTGTAAATAAGGCGG - Intergenic
1155051631 18:22152989-22153011 GTTTTCACTTTTAAATCAGAAGG + Intergenic
1155439069 18:25842473-25842495 GTTTTTAGGAGAAAATCAAGTGG - Intergenic
1156174225 18:34523132-34523154 GTTTTCACTTGTACATCATGAGG + Intronic
1156267565 18:35502269-35502291 GTTTTCAGGAATAACTGAGGAGG - Intergenic
1159391109 18:67793225-67793247 GTTTTAAGGTGCTAATCTGGGGG - Intergenic
1163379943 19:16959293-16959315 AATTCCAGGTGTAATTCAGGAGG - Intronic
1164399705 19:27894163-27894185 GTTTTCAGGTGGAAAACTGGAGG - Intergenic
1165215421 19:34268120-34268142 AAATTCAAGTGTAAATCAGGGGG - Intronic
1166846498 19:45731632-45731654 TTTCTCATTTGTAAATCAGGAGG - Intergenic
926049484 2:9735370-9735392 GTTTTCAGGTGTAAAGGAGGTGG + Intergenic
926399383 2:12480989-12481011 GTCTTCAGGTCAATATCAGGTGG + Intergenic
930207587 2:48603413-48603435 GTTTTTAGGTAGAAATGAGGAGG + Intronic
930395659 2:50820710-50820732 GTTTTCAGTTGTAAACAAGGAGG + Intronic
930907236 2:56586040-56586062 CTTCTCAGTTTTAAATCAGGTGG + Intergenic
931203685 2:60126144-60126166 GTTTGCAAGTGTAAATGATGCGG + Intergenic
931936112 2:67198504-67198526 GTTTTCAGCTGTAAAGCAGTAGG - Intergenic
933297736 2:80509569-80509591 GTTTTCAGGTGCCAAACAGCTGG - Intronic
934057482 2:88263816-88263838 CTTTGCAGGTGTAATTAAGGTGG - Intergenic
936287902 2:111195314-111195336 GTTTTAAGGTGTGAATCTTGGGG - Intergenic
937708009 2:124943654-124943676 GTTTTCAGGTTTTAATCATTTGG + Intergenic
939487014 2:142827159-142827181 GTTTCCAGTTGTAAATAAGTGGG + Intergenic
939802423 2:146726619-146726641 GTTGTCAGGAGTTAAGCAGGGGG + Intergenic
941005972 2:160247468-160247490 GATTGCAGTTGTAAATCAGCAGG - Intronic
942080087 2:172392010-172392032 GTTTTAAGGTTTAAATGAGCTGG + Intergenic
942453704 2:176123605-176123627 GGTTTCAGCAATAAATCAGGGGG - Intronic
947256278 2:228167650-228167672 GTATTCAGGTGAAAATAAGTGGG + Intronic
948164257 2:235849530-235849552 GTTTTCATGTGTGACTCTGGAGG + Intronic
1173713062 20:45177115-45177137 GTTTTAAGATGTGAATGAGGAGG + Intergenic
1175086798 20:56466369-56466391 GTTTTCATTTGTAAAACAAGAGG + Intergenic
1178332979 21:31716652-31716674 GTCTTCAGGTTTAAATTAGATGG - Intronic
1179207962 21:39301283-39301305 GTTTTCTGAAGTAAATGAGGAGG - Intronic
1179355078 21:40651538-40651560 TTTTACAGGTGTAAATCAGAGGG - Intronic
1179958279 21:44753219-44753241 GTTTTCAAGTGTAAAACACGAGG + Intergenic
1180070277 21:45432380-45432402 GCCTCCAGGTTTAAATCAGGTGG + Intronic
1182754036 22:32664374-32664396 GTTTTCAGGGGAAAATCTAGTGG + Intronic
949681027 3:6514658-6514680 GTTTTCAGGGGGAAATAAGAGGG - Intergenic
949732680 3:7131896-7131918 TTCTCCAGCTGTAAATCAGGTGG + Intronic
951077913 3:18419369-18419391 GCCTTCAGGTTTAAATCATGTGG - Intronic
953450675 3:43003085-43003107 ATTTTCCTGTGTAAGTCAGGAGG - Intronic
953922171 3:46959813-46959835 GTTTCCAGGTGTGAAAGAGGTGG - Intronic
954158557 3:48702760-48702782 GTTTTCAAGTGGAAATTGGGTGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969428895 4:7141479-7141501 GTTTTCAGGTATGAAGGAGGTGG - Intergenic
969781389 4:9406828-9406850 GATTACAGGTGTGAGTCAGGTGG - Intergenic
972733479 4:41817642-41817664 GTTTTAAGATGTAAATATGGGGG + Intergenic
980275631 4:130646568-130646590 CTTTTCAGGACTAAATCAGGAGG + Intergenic
984151576 4:176139657-176139679 GTTTTAAGACATAAATCAGGTGG - Intronic
985953611 5:3243198-3243220 GTTTTCAGTTGTATATCAGGTGG - Intergenic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
990140070 5:52693095-52693117 GTTTTCAGGTGTTGCTCAGAAGG - Intergenic
992110640 5:73489749-73489771 GTTATAAAGTGTAAATCGGGTGG - Intergenic
992744746 5:79807982-79808004 GTTTTCAGATCAAAAGCAGGAGG - Intergenic
993833010 5:92782676-92782698 GTTTTCTGGAGTAAATAATGAGG - Intergenic
996564546 5:124865589-124865611 CTTTTCAGGTGTCACCCAGGTGG - Intergenic
996842048 5:127857692-127857714 GTTTTCAGTTCTAAATCTGCAGG + Intergenic
1000123388 5:158219813-158219835 ATTTTCACGTGGAAATCAGCTGG - Intergenic
1002787079 6:410343-410365 GGTTTCAGTTGTAAATGAGTCGG - Exonic
1002805291 6:567890-567912 TTTTTCAGGAGTAAATCATAGGG - Intronic
1004455316 6:15786528-15786550 TTATTCAGGTGAAAATCAGTTGG + Intergenic
1007510345 6:42369965-42369987 GTTTTCATGTGGAGGTCAGGAGG - Intronic
1011822278 6:91267772-91267794 GTTTTCAGATCAAAATCAAGAGG - Intergenic
1012907071 6:105079734-105079756 GTCTTCAGTAGTAAATAAGGAGG - Exonic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1016938564 6:149466346-149466368 GTTTGCCAGTGTACATCAGGTGG - Intronic
1017410033 6:154158167-154158189 GTTTGCAGATATAATTCAGGTGG + Exonic
1019610408 7:1933899-1933921 GTTTTGAGGTGTAACTCAGGCGG + Intronic
1029358086 7:100067696-100067718 GTTTTCATGTATTAATCAGCTGG - Intronic
1033832506 7:145270902-145270924 GATGTCAGTTGTGAATCAGGAGG + Intergenic
1034390596 7:150784583-150784605 GTTTTTAGGGGTGAAACAGGAGG + Intergenic
1036342701 8:7931123-7931145 GATTACAGGTGTGAGTCAGGTGG + Intronic
1040794714 8:51276343-51276365 GTTGTCAGGTGTAAATCCAGAGG + Intergenic
1046373688 8:113347418-113347440 GTGTAAAGGTGAAAATCAGGCGG + Intronic
1050073971 9:1844776-1844798 GATTCCAGGTATAAATCAGTAGG + Intergenic
1050209293 9:3235150-3235172 GTTTACATGTGTTATTCAGGTGG + Intronic
1052104990 9:24502783-24502805 TTTTTCATGTGTAAATGAGAAGG + Intergenic
1056787715 9:89604901-89604923 GCTTTCTGATGTAAATGAGGCGG - Intergenic
1059663626 9:116425529-116425551 GTTTTCAGGTGGAGACCAAGCGG - Exonic
1059937318 9:119323950-119323972 TTTTTCAGGTGAAAATTTGGGGG - Intronic
1186774028 X:12846275-12846297 CTTTTTAGGTGGAAATGAGGAGG - Intergenic
1189113410 X:38317953-38317975 GTTTTCAGGTTTAAATTATAAGG - Intronic
1189168124 X:38881791-38881813 ATTTTCATGTGCAAAGCAGGAGG + Intergenic
1193657804 X:84219977-84219999 GATTTCAGGTGAAAATCCGATGG - Intergenic
1196961453 X:121007517-121007539 TTTTTCAGGTGACAATCAGCTGG - Intergenic