ID: 907389884

View in Genome Browser
Species Human (GRCh38)
Location 1:54151404-54151426
Sequence CTGTGGGTAGGGCTGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 814}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907389884_907389899 28 Left 907389884 1:54151404-54151426 CCTTCTCCCAGCCCTACCCACAG 0: 1
1: 0
2: 5
3: 95
4: 814
Right 907389899 1:54151455-54151477 TGGAATTCCTACAGCCCAGGTGG No data
907389884_907389896 8 Left 907389884 1:54151404-54151426 CCTTCTCCCAGCCCTACCCACAG 0: 1
1: 0
2: 5
3: 95
4: 814
Right 907389896 1:54151435-54151457 AAGGCGCCAGAGCATCAGAGTGG No data
907389884_907389898 25 Left 907389884 1:54151404-54151426 CCTTCTCCCAGCCCTACCCACAG 0: 1
1: 0
2: 5
3: 95
4: 814
Right 907389898 1:54151452-54151474 GAGTGGAATTCCTACAGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907389884 Original CRISPR CTGTGGGTAGGGCTGGGAGA AGG (reversed) Intronic
900151605 1:1181389-1181411 CAGTGGGCAGGGCTGGGAGCAGG - Intronic
900204866 1:1427481-1427503 CTGGGGGCAGGGCAGGGTGATGG - Intronic
900266367 1:1759282-1759304 CTGTGGGTACTGCACGGAGAGGG + Intronic
900266379 1:1759339-1759361 CTGTGGGTACTGCACGGAGAGGG + Intronic
900274581 1:1815962-1815984 CTGTGGGAAGGGCTGGGAAGAGG - Intronic
900330762 1:2133446-2133468 CTGGGGGTAGAGCTGAGGGAAGG - Intronic
900338978 1:2178892-2178914 CCGAGGGTAGAGCTGGGACAGGG + Intronic
900438147 1:2641109-2641131 GTGTGGGGAGGGCTGGGAAGGGG + Intronic
900438177 1:2641173-2641195 CTGTGGGGAGGGTTGGGAAGGGG + Intronic
900438199 1:2641222-2641244 GTGTGGGGAGGGCTGGGAAGGGG + Intronic
900438234 1:2641335-2641357 CCGTGATTAGGGCTGGGAGAGGG + Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900800435 1:4733748-4733770 TTGTGGGCAGGGATAGGAGAAGG + Intronic
900862158 1:5241508-5241530 CAGTGGGTGGGAGTGGGAGAAGG - Intergenic
902414590 1:16231399-16231421 CTGTGGGGGAGGCTGGGACATGG - Intergenic
902533422 1:17105062-17105084 CTGTGGGGAGAGATGAGAGAGGG + Intronic
902672221 1:17982741-17982763 ATGGGCGAAGGGCTGGGAGAGGG + Intergenic
902725708 1:18334755-18334777 CTGTGTGCTGGGCTGGGAGGAGG - Intronic
903138767 1:21326250-21326272 AAATGGGGAGGGCTGGGAGAAGG + Intronic
903424775 1:23245586-23245608 CGGTGGGTTGGGCTGGGTGAGGG + Intergenic
903529627 1:24020312-24020334 CTGGGGGTTTGGCTGGGAGCTGG + Intergenic
903952560 1:27004843-27004865 CTGCGGCTGGGGTTGGGAGAAGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904081540 1:27875532-27875554 CTGTGGGTGGGGCTGGGTTCAGG + Intronic
904318133 1:29679363-29679385 ATGAGTGTAGGGCTGGGGGAAGG + Intergenic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
904453511 1:30632262-30632284 CTGTGGGGAGGGCAGGGCGAGGG + Intergenic
904476040 1:30765209-30765231 CTGTGAGTGGGGCTGGGATCTGG - Intergenic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904825191 1:33269723-33269745 CTGTGGGTTGGGCTGGGGCGGGG + Intronic
904906568 1:33901535-33901557 GTGTGGGTGGGGCTGAGGGAGGG + Intronic
905336058 1:37245349-37245371 CTGCAGGTGGGGCTGGGAGAAGG - Intergenic
905536744 1:38728420-38728442 GTGTGTGTAGGGGTGGGAGTGGG - Intergenic
905769021 1:40625524-40625546 CTGTGGGTAGGGCTGTTTGCTGG - Exonic
905858500 1:41330656-41330678 CTGAGGGCAGGGCAGGGAGGTGG - Intergenic
906247590 1:44287986-44288008 CTCTGGCTAGCCCTGGGAGAGGG + Intronic
906460687 1:46033550-46033572 CTGTGGGTAGGGCTGCAGAATGG + Intronic
906723067 1:48023298-48023320 CAGAGGGTAGGGCTGGGGCATGG - Intergenic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
908079123 1:60556390-60556412 CAGAGGGTGGGGCTGGGAGGAGG - Intergenic
908462339 1:64357577-64357599 GTGGGGGTAGGGGTGGGAGGTGG - Intergenic
909677689 1:78256464-78256486 CTGTCGGTGAGGCTTGGAGATGG - Intergenic
909812909 1:79953717-79953739 CTGAGGGTAGGGCTCTGAAATGG - Intergenic
910764304 1:90765572-90765594 CTGTTGGAAGGGCAGGGTGAGGG - Intergenic
910771547 1:90836345-90836367 GTCTGGGTTGGGGTGGGAGAAGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911533583 1:99075091-99075113 CTGTGGGGCGGCCTGGCAGAGGG - Intergenic
911645231 1:100330607-100330629 CTTTCGGTAGAGCTGGAAGAAGG - Intergenic
912502159 1:110129856-110129878 CTCTGGGCAGGGGTGGGAGTGGG + Intergenic
912647079 1:111403404-111403426 CTGAGGTTAGAGTTGGGAGAGGG - Intergenic
912740127 1:112186688-112186710 CTATGGGTAGGGTTGGGAATGGG - Intergenic
912969658 1:114268860-114268882 CGGAGGGTGGGGGTGGGAGAAGG + Intergenic
914313542 1:146487797-146487819 CAGAGGGTAGGGCTGGGAAGAGG + Intergenic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
914500806 1:148245584-148245606 CAGAGGGTAGGGCTGGGAAGAGG - Intergenic
914685037 1:149970934-149970956 GTCTGGGTTTGGCTGGGAGAAGG + Intronic
915214558 1:154331189-154331211 ATGGGGGTGGGGCTGGGAGTAGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915622243 1:157092851-157092873 CTCTTGGCAGGGCTGGGACAGGG - Exonic
915890866 1:159772637-159772659 CTGTGTGTAAGGGTGGGACATGG - Intergenic
915903942 1:159864660-159864682 CTGTGGTTAGGGTTGGAACATGG + Intronic
916075457 1:161197792-161197814 CGGTGGGTCTGGCTAGGAGAAGG + Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916719585 1:167474206-167474228 CTGGGGGTGGGGCTGGGAAGGGG + Intronic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917512745 1:175681760-175681782 CAGAGGGAAGGGCTGGGAGCAGG + Intronic
917598533 1:176553239-176553261 CGGTGGGTAAGGCAGGGAGGGGG + Intronic
917967505 1:180187755-180187777 CTCGGGGTAGGGCTGGCAGTGGG + Intronic
918224725 1:182471208-182471230 CAGTGTGCAAGGCTGGGAGAGGG + Intronic
918950033 1:191125451-191125473 CTGAGGATGGGGTTGGGAGAAGG - Intergenic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
919748771 1:201023910-201023932 GTGGGGGTAGGGGTGGGAGTAGG + Intergenic
920041286 1:203099306-203099328 CTGGGGGTGGGGTAGGGAGAGGG - Intronic
920387779 1:205580540-205580562 CAGAGGGTGGGGCTGGGGGAGGG + Intronic
920399801 1:205669751-205669773 CTGTGGGGAGGGCTGCGGGGTGG - Intronic
920415516 1:205796879-205796901 CAGAGGGCAGGGCTGGGGGAAGG - Intronic
920502957 1:206496975-206496997 CTGTGAGAAGTGCTGGGAAATGG + Intronic
920657576 1:207888005-207888027 GTGGGGGCAGGGGTGGGAGAAGG + Intronic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920765157 1:208825541-208825563 CTGTGCTTAGGGCTGGCAGTGGG - Intergenic
921014852 1:211179837-211179859 CTGAGGGTGGGGCTGGGGAAAGG - Intergenic
921338035 1:214107866-214107888 CTGGGGGTGGGGGTGGGAGGCGG - Intergenic
921490464 1:215769661-215769683 ATGGGGGTAGGGCTGGTGGAAGG + Intronic
922590027 1:226768401-226768423 CTGAGGGTTGGGGTGGGAGAGGG + Intergenic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922707381 1:227796529-227796551 CTGTGGGTGGGGCCGGCAGTAGG - Intergenic
922770162 1:228177309-228177331 CCGTGGGTGTGGCTGGGTGAGGG + Exonic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924198881 1:241639861-241639883 CGGTGAGTTGGACTGGGAGAAGG - Exonic
1062830771 10:604018-604040 CTGAGGGCAGGGCTGGGGGGTGG - Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1063709717 10:8465448-8465470 TTGAGGGTAGGGGTGGGAGGAGG + Intergenic
1063830817 10:9950605-9950627 TGGTGGGTAGGGTTGGGGGAGGG - Intergenic
1064525383 10:16250386-16250408 ATGTGTGTCGGGCTGGGGGAAGG - Intergenic
1064554295 10:16533135-16533157 CTGAGTGGAGGGCTGGGAGTGGG + Intergenic
1065310980 10:24415796-24415818 CTCTGGCCAGGGCTGAGAGAAGG + Intronic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1067509254 10:46881740-46881762 CTCTGGGCAGGGCTGGGGGGAGG + Intergenic
1067652998 10:48170115-48170137 CTCTGGGCAGGGCTGGGGGGAGG - Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069928143 10:71865501-71865523 GCGGGGGTGGGGCTGGGAGAGGG - Intergenic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070655694 10:78269682-78269704 CTGTGGCTGGGACTGGGATAGGG + Intergenic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1070800410 10:79242023-79242045 AGGTGGGTGGGGCTGGGGGAGGG + Intronic
1071354785 10:84783719-84783741 CTGTGGGGAGGGGTGTGAGGGGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1072489907 10:95894788-95894810 TTGGGGGAAAGGCTGGGAGAGGG + Intronic
1072765272 10:98089896-98089918 CTGTGGCTTGGTCTGGGTGATGG - Intergenic
1073452181 10:103616570-103616592 CTGTGATTAGGCCTGGGAGAGGG + Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074756315 10:116627023-116627045 CTGTGGGTAGGGGTCAGAGAGGG + Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1074814586 10:117134680-117134702 CTGCGGATAGGGCTGGGACTTGG - Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075259873 10:120953956-120953978 GTGTGGCTGGGGCTGGGAGAGGG + Intergenic
1075654145 10:124150375-124150397 CTCAGAGTAGGGCTGGGAGGGGG + Intergenic
1075664440 10:124220700-124220722 CTGGGTGCAGGGCTGGCAGAGGG - Intergenic
1075945871 10:126432613-126432635 CTGTGGGAGGATCTGGGAGAAGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076150573 10:128159202-128159224 GCGTGGGTGGGGCTTGGAGAGGG + Intergenic
1076596953 10:131629279-131629301 CTGGGGGTGGGGCTGAGGGAAGG + Intergenic
1076653579 10:132006330-132006352 GTGGGGGTGGGGGTGGGAGAGGG + Intergenic
1076774716 10:132688317-132688339 CTGGGGGCAGGGCTGCAAGAAGG - Intronic
1076826377 10:132971689-132971711 CTCTCGGTGGGGCTGGGAGTGGG + Intergenic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1077143449 11:1034847-1034869 CTGCGGGTGGGGCAGGGCGAGGG - Intronic
1077169191 11:1158832-1158854 CTGGGGACAGGGCTGGGCGAGGG - Intronic
1077292252 11:1803274-1803296 CTGTGGGCAGGGCCAGGAGGGGG + Intergenic
1077311521 11:1890928-1890950 GTGTGGGCTGGGGTGGGAGACGG + Intronic
1077333400 11:1993162-1993184 CCATGGGCAGTGCTGGGAGATGG + Intergenic
1077356812 11:2122497-2122519 TTGGGGGGAGGGCTGGGAGCGGG + Intergenic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078702712 11:13703752-13703774 GTGTGGGGAGGGCTGGGCGTGGG + Intronic
1079460817 11:20676347-20676369 CTGTGGGTTAGGTTGGGGGAGGG - Intronic
1080169452 11:29281776-29281798 GTGAGGGGAGGGCTGGGGGAGGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081538955 11:44016319-44016341 CAGTGGGCAGGCCTGGGAGGTGG + Intergenic
1081661944 11:44893831-44893853 ATGTGGGGAGGACTGGGACAGGG - Intronic
1081737299 11:45412898-45412920 GTGTTGGGAGGGCTGGGTGAAGG - Intergenic
1082018954 11:47514973-47514995 CTGTGGTGAGAGCTGGGAGGTGG + Intronic
1082787835 11:57326660-57326682 CTGTGGGCTGGGCAGGGTGAGGG - Intronic
1082798092 11:57393100-57393122 CTGTGGGGAGGGCTTGCAGATGG - Intronic
1083615500 11:64024052-64024074 CTGGGGACAGGGCTTGGAGAGGG - Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083885006 11:65568971-65568993 TTCAGGGTAGGGCTGGGAGCTGG + Intergenic
1083886726 11:65576674-65576696 CTGCGGTCAGGGCTGGGGGAGGG + Intronic
1083889726 11:65589774-65589796 CTGTGGGTGGGCCTGGGGCAGGG - Exonic
1083903402 11:65654788-65654810 CTGGGGCTAGGACTGGGACAGGG + Exonic
1084537907 11:69768686-69768708 CTGTGGGATGGGCAGGGAGGAGG - Intergenic
1084566471 11:69931562-69931584 CTGCGGCTAGGGCTGTCAGATGG - Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085309021 11:75505331-75505353 CTGGGGGTGGGGCTGGGGGCCGG - Intronic
1086379380 11:86236433-86236455 CAGAGGGTAAGGCTGAGAGATGG - Intergenic
1086416003 11:86589333-86589355 ATGGGGGTAGGGTTGGGGGAGGG + Intronic
1086752022 11:90508330-90508352 CTTGTGGTAGGGCTGGGGGAAGG - Intergenic
1087196092 11:95305603-95305625 CTCAGGGTAGGGCTGAGTGAGGG - Intergenic
1087831359 11:102822957-102822979 CTGTGGGTGGAGCAGGGAGTTGG - Intergenic
1088318462 11:108530922-108530944 TTGTGGGAAGGCCTGGGAGTGGG - Intronic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1088724410 11:112621413-112621435 CTGAGGCCAGGGTTGGGAGAGGG + Intergenic
1088923432 11:114278578-114278600 CTGTTGGTAGGGGTGGGAGGTGG + Intronic
1089201869 11:116729533-116729555 CTGGGGGTGGAGCAGGGAGATGG + Intergenic
1089492383 11:118892147-118892169 CTGCGGGAAGGGTTGGCAGATGG + Intronic
1089493574 11:118897875-118897897 CTGCAGGGAGGGGTGGGAGAGGG + Exonic
1089621755 11:119726716-119726738 TGGTGGGAAGGGTTGGGAGAAGG - Intronic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089736609 11:120554077-120554099 CTGTGGGTGGGGGTGTGAGTGGG - Intronic
1089794503 11:120969432-120969454 CTGTGGGCAGGGCTGTGTGCAGG + Intronic
1089912404 11:122114790-122114812 CTGTGGGTAGGTATGGGTCAGGG + Intergenic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090664601 11:128906064-128906086 CAGGGGGCAGGGCTGGGAAAGGG - Intronic
1090703427 11:129315977-129315999 CTCTGGGCAGGGCTGCGAGAGGG - Intergenic
1091032629 11:132204668-132204690 CTGTGGGAAGAGCATGGAGAGGG + Intronic
1091215778 11:133900607-133900629 CTGTGGGCCGGCCTGGGAGAGGG - Intergenic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1202816378 11_KI270721v1_random:48343-48365 CCATGGGCAGTGCTGGGAGATGG + Intergenic
1091488704 12:914692-914714 CTGTAGGTAGGACTGGGACTCGG - Intronic
1091756552 12:3056175-3056197 GTTTGGGTATGGCTGGGAGGGGG - Intergenic
1091759602 12:3077846-3077868 CTTCGGGCAGGGCTGGGATATGG + Intronic
1091784496 12:3234716-3234738 CTGATGGCAGGGCTTGGAGAAGG + Intronic
1091891568 12:4059206-4059228 CTGATGCTAGGGCTGGGACAAGG - Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092103785 12:5906157-5906179 TTGGGGGCAGGGCTAGGAGAAGG + Intronic
1092205953 12:6614215-6614237 CACGGGGTGGGGCTGGGAGAGGG - Intergenic
1092728125 12:11504421-11504443 CTGTGGGGAGGACAGGGAGCTGG + Intergenic
1092903983 12:13085651-13085673 GTGTGTGTTGGGGTGGGAGAGGG - Intronic
1094191822 12:27705887-27705909 CAGTTGGTAGAGGTGGGAGATGG - Intergenic
1094478947 12:30864831-30864853 CTGTGGGTAGGAGTGGGAAGGGG - Intergenic
1094814055 12:34166683-34166705 GTGCGGGTGGGGGTGGGAGAGGG - Intergenic
1095102849 12:38201821-38201843 ATGAGGGTGGGGGTGGGAGAGGG + Intergenic
1095837747 12:46656560-46656582 CTGAAGGTAGGGGTGGGAGAGGG + Intergenic
1096466383 12:51849174-51849196 CGGCGGGTAGGGGTGGGGGACGG + Intergenic
1096651351 12:53063470-53063492 CTGGGGCTGGGGCTGGGAGCTGG - Intronic
1097259965 12:57713534-57713556 CTGTGGGTGGGGCTGAGTGGAGG + Intronic
1097846949 12:64376604-64376626 CAGAGGGTGGGGGTGGGAGAAGG - Intronic
1098213707 12:68193618-68193640 CTGTGGGAAGGCCTGGGGAAGGG + Intergenic
1098245917 12:68517729-68517751 GTGAGGGTTGGGCAGGGAGACGG - Intergenic
1098289187 12:68940204-68940226 ATGTGGGTAGGGCAGGAAAAGGG - Intronic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100715846 12:97304314-97304336 TTCTGGGAAGGGCTGGGAGATGG + Intergenic
1100974335 12:100106600-100106622 AGGTGGGTAGGGGTAGGAGAGGG + Intronic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101333832 12:103778934-103778956 CTGTGTTTAGGTTTGGGAGATGG - Intronic
1101426609 12:104593365-104593387 CTGTGGGAGGGACTGGGTGAGGG + Intronic
1101564784 12:105895170-105895192 CTGTGGGTAGGGTTCGGGGGTGG - Intergenic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102452433 12:113052007-113052029 CTGAGGGTGGGGCTTGGACATGG + Intergenic
1102490221 12:113286098-113286120 CTGTGGGCAGGGCTGCTTGAGGG - Intronic
1102493518 12:113303751-113303773 CTGTGGGCAGTGCTGGGATATGG + Intronic
1102654469 12:114469909-114469931 CTGGGGATGGGGGTGGGAGAAGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103564875 12:121810552-121810574 CAGTGGGGAGAGCTGGGAGGAGG - Exonic
1104006374 12:124895633-124895655 CTGTGGGTAAGGCTGGGAATTGG + Intergenic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104123240 12:125819302-125819324 CAGTGGGTAGGGCTGAAAGGTGG + Intergenic
1104359623 12:128120607-128120629 CTGCAGGTAGGGCTGGGAAAAGG - Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104729259 12:131095993-131096015 CTCTGGGCAGGGCTGGGAGGCGG - Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105639251 13:22245288-22245310 CTTTGACAAGGGCTGGGAGATGG - Intergenic
1105681234 13:22729283-22729305 CTGGGGGAAAGGGTGGGAGAGGG + Intergenic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1105847563 13:24307223-24307245 CACTGGGTAGGCGTGGGAGAAGG + Exonic
1105855159 13:24365787-24365809 GTTTGGGTGGGGCTGGGAAATGG - Intergenic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1108361842 13:49674981-49675003 CTGGGTGTTGGGCTGAGAGAGGG - Intronic
1109273442 13:60279493-60279515 CCCTGGGTTGGGCTGGGAGCAGG + Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1112041411 13:95552358-95552380 CCTTGGGTAGGGCTGGGTGGGGG + Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112436033 13:99391948-99391970 CAGTGGGTAGGGCTGGGGCAGGG + Intergenic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113574414 13:111383865-111383887 CTGGCTGTGGGGCTGGGAGAAGG + Intergenic
1114169293 14:20255571-20255593 CTGTTTCTAGGGCTGGGACAAGG + Intergenic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1115347900 14:32362834-32362856 GTGTGGGGAGGGCTGGAAGTGGG + Intronic
1116012667 14:39369158-39369180 TTGTGGGTAGGGCTTGGGGAGGG + Intronic
1116855044 14:49944666-49944688 CTGTGGGTGGGAGTGGGGGATGG + Intergenic
1117537115 14:56713013-56713035 GTGTGCGTAGGGCTGGAACAAGG - Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118610561 14:67536300-67536322 CTGGGGATGAGGCTGGGAGAAGG - Intronic
1118735429 14:68697518-68697540 CAATGGCTAGGGCTGGGGGAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119805332 14:77478482-77478504 ATGTGGGTGGGCTTGGGAGATGG - Intronic
1119888605 14:78165431-78165453 CTGTGCGGAGGGCTGGCAAAAGG + Intergenic
1120220241 14:81723469-81723491 TTGTGGGTGGAGGTGGGAGAGGG + Intergenic
1120235205 14:81882497-81882519 CTGGAGTTAGGGCTGGGAGCAGG + Intergenic
1120630937 14:86889274-86889296 CTGGAGGTAGGGTTGGGGGATGG + Intergenic
1121324351 14:93011375-93011397 AAGTGAGTAGGGCTGGGAGCTGG - Intronic
1121326055 14:93020171-93020193 GTGGGGGCAGGGCTGGGAGACGG + Intronic
1121588290 14:95079021-95079043 CTGAGGGTGGGGCTGGGTGTGGG + Intergenic
1121722436 14:96119238-96119260 ATGTGGTTAGGGCTGGGCAAAGG - Intergenic
1122116446 14:99529892-99529914 TTGTGGGAAGGACTGGGAGTCGG - Intronic
1122169579 14:99861183-99861205 CTGTGTGTAGGCCTGGGAGCAGG + Intronic
1122279182 14:100611068-100611090 CAGCGGAGAGGGCTGGGAGAGGG - Intergenic
1122551605 14:102553016-102553038 CTCTGGGCAAGGCTGGGAGTGGG - Intergenic
1122776312 14:104118387-104118409 CTGCGGGGAGTCCTGGGAGATGG + Intergenic
1122795881 14:104205980-104206002 GTGTGTGCAGGGCTGGGAGCTGG + Intergenic
1122796935 14:104210710-104210732 CGGGGGGCAGGGCTGGGGGAGGG + Intergenic
1122844048 14:104481064-104481086 GTTTGGGTGGGGCTGGGAAATGG - Intronic
1122884188 14:104703272-104703294 CTGTGGGGAGGGCGGGGTCAGGG - Intronic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123039126 14:105483218-105483240 CTGGGGGCAGGGCTGGCTGAGGG + Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1125242045 15:37586965-37586987 CTCTGGGGAGGGGTGGCAGAAGG - Intergenic
1125814967 15:42576065-42576087 CTTTGAGAAAGGCTGGGAGAGGG + Intronic
1126241872 15:46454377-46454399 CAGTGGGTAGGGGTGGGGTAGGG - Intergenic
1126383943 15:48074984-48075006 GTGGGGGACGGGCTGGGAGAAGG - Intergenic
1127157327 15:56141272-56141294 CTGGGGGTGGGGGTGGGAGTGGG + Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1128240143 15:66096110-66096132 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
1128571420 15:68736239-68736261 AAGTGGGTGGGGCTGTGAGAAGG - Intergenic
1128767493 15:70260022-70260044 CACTGGGTAGGGCTGGGGTAAGG + Intergenic
1128804029 15:70517488-70517510 CCCTGGGCAGGGCTGGGGGAAGG - Intergenic
1128938230 15:71766318-71766340 CTGTGGGTTGGGGTGGGAAGTGG + Intronic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129205975 15:74037197-74037219 CTGAGGGTGAGGCTGGGACAAGG - Intronic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129609627 15:77042983-77043005 CTGTGGGTCAGGCTGGCAAAGGG - Exonic
1129673053 15:77617579-77617601 GTGTGGGAAGGGGTGGGAGAAGG - Intronic
1129698582 15:77754648-77754670 CTGGGGGTGGGGCTCTGAGAAGG + Intronic
1130044816 15:80435491-80435513 CTATGGGAAGGGGTGGGAAAGGG - Intronic
1130460655 15:84156630-84156652 ATGGGGGAAGGGCTGGGAGGAGG - Intergenic
1130809918 15:87365965-87365987 TTGGGGGTAGGGGTGGGAGTTGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131436488 15:92426629-92426651 CTGGGGGTGGGGCTGTGAGGAGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132588515 16:716341-716363 TTGTTGGTTGGGCTGGGGGAGGG - Intronic
1132607128 16:798313-798335 GTGTGAGTGGGGCTGGGAGTGGG + Exonic
1132863609 16:2083229-2083251 CTGTGGGTCTGGCTTGGAGTTGG + Intronic
1132872789 16:2123193-2123215 CTGGGGTGAGGGCCGGGAGAAGG - Intronic
1133233049 16:4375296-4375318 CAGCTGGCAGGGCTGGGAGAGGG - Intronic
1133258451 16:4533306-4533328 CTATGGGTCTGACTGGGAGATGG - Intronic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134060220 16:11195006-11195028 CTGGGGGTCAGGCTGGGATAGGG + Intergenic
1134299351 16:12975727-12975749 TTGTAGGTGGGGCTGGGAGGGGG + Intronic
1134373064 16:13643738-13643760 CTGTGGGGAGGGCAGTGAGAGGG + Intergenic
1134551877 16:15142372-15142394 CTGGGGTGAGGGCCGGGAGAAGG - Intergenic
1135159206 16:20078633-20078655 CTGTGGTTGGGGCTTGGATATGG + Intergenic
1135194835 16:20386029-20386051 GTGTGGGGAGGGCGGGGATAGGG + Intronic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135995023 16:27241352-27241374 CTGTCGGGAGGGCTGTCAGAGGG - Intronic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1136076908 16:27823462-27823484 GTGGGGGTAGGGGTGGGAAAGGG + Intronic
1136368746 16:29822547-29822569 CTGTGGGAAGGTCTGGGGGCAGG + Intronic
1136393978 16:29982969-29982991 GTGTGAGTAGGGCTGGGGAAGGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136620844 16:31427698-31427720 CTGTGGGGAGGGCGGGGCCACGG - Intergenic
1137300559 16:47144104-47144126 CTGCCGTTAGGGCTGGGAGCCGG + Intergenic
1137551370 16:49439930-49439952 CTGAGGGTAAGGCTCTGAGATGG - Intergenic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1137775750 16:51053153-51053175 TTTTGGGTGGGGGTGGGAGATGG - Intergenic
1138830910 16:60373740-60373762 CTGTGGTTGGGGCAGCGAGAGGG - Intergenic
1140636804 16:76924520-76924542 CTGTGGGTAGGACTGGGAACTGG + Intergenic
1140826908 16:78715460-78715482 CGGTGGGTAGGGGTGGGGGTGGG - Intronic
1140888093 16:79261907-79261929 CAGTGGAGAGGGCTGGGAGAAGG + Intergenic
1141079827 16:81040317-81040339 CAGTGGGTGGGGGTGGGAGGAGG + Intronic
1141168544 16:81676800-81676822 CTGGGGGAAGGGGTGGGAGGGGG - Intronic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141489394 16:84361798-84361820 GTGGGGGTGGGGCTGGGAGAAGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141807504 16:86351692-86351714 CTGGGGCTATGGCTGGGAGCTGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142006444 16:87691593-87691615 CTGGGGGTGGGGCTGGCAGGAGG - Intronic
1142194546 16:88733395-88733417 GCGTGGGTAGGGCAGGGCGAAGG + Exonic
1142198960 16:88752044-88752066 CTGTGGGGAGGCCAGGGAGGTGG + Intronic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142380714 16:89730421-89730443 GTGTGAGGAGGGCTGGGAGCTGG + Intronic
1142502499 17:340621-340643 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502574 17:340837-340859 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502612 17:340944-340966 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502637 17:341015-341037 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142502659 17:341085-341107 ATGTGGGGAGGCCTGGGAGGGGG - Intronic
1142613843 17:1123981-1124003 CTGTGGGAAGGGCTGGCGGGGGG - Intronic
1142761557 17:2045013-2045035 GTGTGGGGAGGGGTGGGAGGTGG + Intergenic
1142807951 17:2381326-2381348 CAGGGGGTAGGGATGGGACAGGG - Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1143048341 17:4101000-4101022 AAGTGGGTGGGGCTGGGAGGGGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143287407 17:5800546-5800568 GTGTGGCTAGGGCTGGATGAAGG + Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1143481368 17:7229342-7229364 CTGTGGCTAGGGCGTGGGGAGGG - Intronic
1143519975 17:7439496-7439518 CTGTGGGTGGGGCAGCGAGTCGG + Exonic
1143619622 17:8073458-8073480 CTGGGGGTGGGGCTGGGTGTGGG + Intronic
1143697490 17:8630942-8630964 CTGTGGCCTGGGCTGGGAGCGGG - Intergenic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1143908996 17:10232067-10232089 AAGAGGGCAGGGCTGGGAGAAGG + Intergenic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144188061 17:12814988-12815010 CCCTGGGTAGGGGTGGGAGAAGG - Intronic
1144190112 17:12837800-12837822 TTCTGGGTAGGGGTGGGAAATGG + Intronic
1144728305 17:17512655-17512677 CTGTGGGCAGGGGATGGAGAGGG + Intronic
1145251264 17:21298157-21298179 CAGTGGGCAGGGCTGAGATAAGG + Intronic
1145975143 17:28979539-28979561 CTAAGGCCAGGGCTGGGAGATGG - Intronic
1146029975 17:29357722-29357744 CTGGGGCTAGGGTTGGGAGCAGG - Intergenic
1146430079 17:32784821-32784843 CTGTGGGGAGGGGTGGGGTATGG + Intronic
1146446283 17:32935564-32935586 CTGTGGTGGGAGCTGGGAGAGGG + Intronic
1148052706 17:44776967-44776989 GTCTGGCTAGGGCTGGGAGTGGG + Intronic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148682042 17:49479686-49479708 CTATGGGTGGGGTTTGGAGAAGG + Intergenic
1148849577 17:50548160-50548182 AGGTGGGTTGGGCTGGGAGCAGG + Intronic
1148943999 17:51242273-51242295 CTGTGGGGATGGCTTGGAGTTGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150241993 17:63641835-63641857 GTTTGGGGAGGGGTGGGAGAGGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150289572 17:63973581-63973603 CTTGGTGTTGGGCTGGGAGAGGG + Intergenic
1150611569 17:66737706-66737728 CAGTGGGAACGGCTGGGAGCAGG - Intronic
1150620467 17:66804065-66804087 CTGCGGGGAGGGCTGGGGGCTGG - Exonic
1150836517 17:68568896-68568918 TTTTGGGTAGGGGTGGGAGCAGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151371444 17:73648651-73648673 CTGTAGGTGGGGCTGGGCCAGGG + Intergenic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1151535708 17:74737691-74737713 GGCTGGGAAGGGCTGGGAGATGG + Intronic
1151625426 17:75272671-75272693 CTGTGGGCAGGCGTGGGTGAAGG - Intergenic
1151714518 17:75824711-75824733 CAGTGGGAAGGGCAGGGAGTGGG - Exonic
1152002331 17:77654565-77654587 CTTTTGCTTGGGCTGGGAGATGG - Intergenic
1152024741 17:77801586-77801608 ATGTGGGTGGGGCTGGGGGTGGG - Intergenic
1152106074 17:78329795-78329817 CTGTGGTCAGAGCTGGCAGAGGG - Intergenic
1152367800 17:79866776-79866798 TTGTGTGTGGGGCCGGGAGAAGG - Intergenic
1152686587 17:81696725-81696747 CTGGGCGTAGGGCAGGGGGAAGG - Exonic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1152922015 17:83070417-83070439 GGGTGGGCAGGGCTGGGAGGTGG + Intergenic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153254609 18:3157900-3157922 CTATTTGGAGGGCTGGGAGAGGG - Intronic
1153402982 18:4701566-4701588 TTGTGGGTAAGGGTGGGAGGGGG + Intergenic
1153526377 18:5998490-5998512 CTGAGGGTGGGCCTGGGGGAAGG + Intronic
1153778877 18:8477097-8477119 CAGTGGGTAAGTGTGGGAGAAGG - Intergenic
1155161618 18:23200804-23200826 CTGTGGATAGAGCAGTGAGAAGG + Intronic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1155602791 18:27568844-27568866 CAGGGGGTGGGGCTGGGAGTGGG + Intergenic
1156366081 18:36428539-36428561 CTGAGGGTGGGGCTGGGGGCGGG + Intronic
1156500996 18:37558244-37558266 CTGTGGGTAGGGCTGTGGCTTGG + Intronic
1156790373 18:40965280-40965302 TTGAGGGTGGGGCTGGGAGGGGG + Intergenic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157359404 18:46964023-46964045 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157360998 18:47023542-47023564 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157361988 18:47029457-47029479 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157362866 18:47034879-47034901 CTGTGCTCAGGGCTGTGAGATGG + Exonic
1157552228 18:48589761-48589783 GTGTGGGGGGAGCTGGGAGATGG + Intronic
1157681177 18:49608214-49608236 CTGGGGCTAGGGCTGGGTGAGGG + Intergenic
1158630634 18:59111304-59111326 CTTTGGGTAGGGCATGGAGTGGG + Intergenic
1160368548 18:78350397-78350419 CTGTGGGAAGGGGTGTGAGGTGG - Intergenic
1160443999 18:78913367-78913389 CTGTGAGCAGGGGTGGGAGTGGG - Intergenic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161009815 19:1954724-1954746 CTGAGGCTAGGGCTGGGGAAGGG + Intronic
1161039305 19:2101564-2101586 CTGTGGGCAGGGCGGGGCCAGGG - Exonic
1161141560 19:2651167-2651189 CAGTGGGGAGGGCCGGGAGGCGG - Intronic
1161746907 19:6065993-6066015 CTGGGGGCGGGGCTGGGAGGAGG + Intronic
1161753428 19:6114129-6114151 CTCTGGCCAGGGCTGGGAGCGGG - Intronic
1161871301 19:6872452-6872474 CAGGGGGTGGGGTTGGGAGAGGG + Intergenic
1162034509 19:7931902-7931924 CTTCGGGCAGGGCTGGGAGGTGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1163124184 19:15235752-15235774 CTGTGGGAAGGGTTGGGAAATGG + Exonic
1163452603 19:17387394-17387416 GTGTGTGTAGGGCTTGGGGAGGG - Intergenic
1163499797 19:17669510-17669532 CTGGGGCTGGGGCTGGGTGAAGG + Intronic
1163730042 19:18943650-18943672 CTCTGGGAGGGGCTGGGACAGGG + Intergenic
1163892586 19:20030010-20030032 ACGTGGGTAAGGCTGGGACAGGG + Intronic
1165312835 19:35039367-35039389 CTCTGGGTAGTACTGAGAGATGG - Intronic
1165394753 19:35558164-35558186 CTGTGGGCGGGGCTGGGTGGTGG + Intronic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165726583 19:38117146-38117168 CAGTGAGCAGGGCTGGGAGGAGG - Intronic
1165773623 19:38392138-38392160 CTGTGGGCTGGCCTGGGAGCGGG + Intronic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1165853963 19:38869167-38869189 CTGTGGGGAGAGGTGGGAGCTGG + Intronic
1165925002 19:39321096-39321118 CTGGGGGTGGGGCTGGGGAAGGG - Intergenic
1166284268 19:41814164-41814186 GTGTGGGAAGGACTGGCAGATGG - Intergenic
1166689511 19:44814129-44814151 CTAAGGGAAGGGCAGGGAGATGG - Intronic
1166882606 19:45938606-45938628 CTGGAGGGAGGGGTGGGAGATGG - Exonic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167461060 19:49624998-49625020 CTGGGGCTGGGGCTGGGAGTGGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1167679169 19:50909088-50909110 CAGAGGGAAGGGCTGGGAGGCGG - Intronic
1167859539 19:52271540-52271562 CTGTGAGTAGGGCTGGCACCTGG - Intronic
1168148083 19:54430583-54430605 CTGTTGGAAGGGGTTGGAGACGG - Exonic
1168306581 19:55439181-55439203 TTGAGGGAAGGGATGGGAGATGG - Intronic
1168714777 19:58520259-58520281 CTGTGGGTGGGACTGGGGAAAGG + Intronic
925703382 2:6661357-6661379 CTGTGGGCAGCGCTCTGAGAGGG - Intergenic
925996302 2:9296325-9296347 CCGTGGGTAGGAATGGGGGAGGG - Intronic
926104483 2:10141784-10141806 CTGGGGCTGGGGCTGGGAGGCGG + Intronic
926224884 2:10960769-10960791 CTGCAGGCAGGGCTGGGTGAGGG + Intergenic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
927708745 2:25312553-25312575 CTGTGGGAAGGGCTCGGACCTGG + Intronic
927945028 2:27130522-27130544 GTATGGGAAGGGCTAGGAGAGGG - Exonic
927966560 2:27273661-27273683 CTGTGGTCAGTGCAGGGAGAGGG - Intronic
928166034 2:28972792-28972814 TTCTTGGTAGGGCTGGGAGCTGG + Intronic
928466513 2:31527736-31527758 CTGTGAGGAGGGGTGGCAGAGGG - Intronic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
931385831 2:61796438-61796460 GTGTGGGGGGCGCTGGGAGAGGG + Intergenic
932189817 2:69731312-69731334 GTCTGGGTAGGTCTGGCAGATGG - Intronic
932319282 2:70809215-70809237 ATGAGGACAGGGCTGGGAGAAGG + Exonic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
933580051 2:84115915-84115937 TTGGGGGTAGGGATTGGAGATGG - Intergenic
934680331 2:96278999-96279021 CTGTGGGTTGGAGAGGGAGAAGG + Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934942931 2:98515463-98515485 CGGTGGGTGGGGCAGGGAGAGGG + Intronic
934950128 2:98570474-98570496 CTGTGGTGAGGGCTGGGCCAGGG + Intronic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
935208954 2:100922118-100922140 CTGTGGCTATGGCTGGGGGTGGG + Intronic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
937030190 2:118732347-118732369 CTTTGGGTAGGGCTGGTGGGGGG + Intergenic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937054217 2:118918027-118918049 CTGTGGCCAGGGGTGGTAGAAGG - Intergenic
937345155 2:121120963-121120985 CTGTGGGGAGAACTGGGGGAGGG - Intergenic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939608373 2:144279941-144279963 AAGGGGGTGGGGCTGGGAGAAGG + Intronic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941031706 2:160519158-160519180 CTGTGGGAAAAGTTGGGAGAGGG - Intergenic
941280342 2:163542159-163542181 CTGAGGCTGGGGCTGGGAGTGGG - Intergenic
941396851 2:164983878-164983900 CTTTGGGTATGGGTGTGAGAGGG + Intergenic
941684082 2:168429884-168429906 TTGTAGGTAGGGATAGGAGAAGG - Intergenic
941781662 2:169452324-169452346 GTGGGGGTAGGGGTGGGAGGTGG - Intergenic
941901121 2:170679506-170679528 CTGTGGGTGGGGCGGGGCGGGGG - Intergenic
942358372 2:175144681-175144703 TTGAGGGTTGGGCTGGGAAAGGG + Intronic
942360496 2:175167610-175167632 CCTTGGGTTGGGCGGGGAGAGGG - Intronic
942855003 2:180534953-180534975 CTGTGGCTAGGCCAGAGAGATGG - Intergenic
943675907 2:190716330-190716352 CTGAAGGTAGGACAGGGAGAAGG + Intergenic
944442001 2:199752222-199752244 CTGTGGGGTGGGGAGGGAGAGGG - Intergenic
945539818 2:211071485-211071507 CTGTATGCTGGGCTGGGAGATGG - Intergenic
945562188 2:211352815-211352837 CTGGGGCTAGAGCTGGGAGCAGG + Intergenic
946089760 2:217210527-217210549 CGGGGGGTGGGGTTGGGAGAGGG - Intergenic
946146395 2:217734416-217734438 CTGTGGTCAGGGTTGAGAGAGGG - Intronic
946374553 2:219300165-219300187 CTGGAGGTAGGGCTGGCAGTGGG + Exonic
946401412 2:219470384-219470406 CTGTGGGCAGGGGTTGGAGCCGG - Intronic
946408882 2:219506793-219506815 CTCTGAGTAGGGCTGCCAGAAGG + Exonic
947136943 2:226984917-226984939 CTGGGGGTTGGGGTGGGGGAGGG + Intronic
947389054 2:229621455-229621477 TGGTGGGCAGGGCTGGGAGCAGG - Intronic
948422326 2:237867484-237867506 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
948536329 2:238650317-238650339 CTGTGGGGAGGGCAGGGTTAAGG + Intergenic
948672260 2:239576074-239576096 GTTTGGGCAGGGCTTGGAGAGGG + Intergenic
948676973 2:239602532-239602554 GCCTGGGTAGGGCTGGGACACGG - Intergenic
948722725 2:239911738-239911760 CTGGGGGATGGGCTGGGGGAAGG - Intronic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1172119551 20:32589720-32589742 CTGTGGTCAGAGCTGGGAGGGGG - Intronic
1172126337 20:32627213-32627235 CTGTGGGCAGGTCGGGGAGTGGG - Intergenic
1172444518 20:34986053-34986075 CTCTGGGGAGGTGTGGGAGATGG + Intronic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1172874246 20:38154735-38154757 TTGGGGGGAGGGCTGGGGGAGGG - Intronic
1172917334 20:38452890-38452912 CTGAGGGTAGGGTCGGGCGAGGG - Intergenic
1173121187 20:40290958-40290980 CTGGGGGTAGGGGTGGGATCAGG - Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173475995 20:43360151-43360173 GAGTGAGTAGGTCTGGGAGAGGG + Intergenic
1173691219 20:44962606-44962628 CTTTGGGTAGTGCTGGGTTAAGG + Intergenic
1174460409 20:50678397-50678419 CTGTGGGGTGGGGTGGGAGGTGG - Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175980564 20:62736518-62736540 CTGTGGGTGGGGCAAAGAGAGGG + Intronic
1175984631 20:62758500-62758522 CTGTGACTGGGGCCGGGAGAAGG + Intronic
1176020840 20:62961625-62961647 CTGTAGGTGGGGCCGGGAGCAGG + Intronic
1176241364 20:64077276-64077298 CTTTGGGAGGGGCTGGGAGCCGG - Intronic
1176726640 21:10440928-10440950 CTGTGGGTAGGAGTGGGGAATGG + Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1178684857 21:34702760-34702782 GTGTGGGTGGGACTGGGAGGAGG + Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179635947 21:42709296-42709318 CTGTTGGGAGGGTTGGGGGAGGG + Intronic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1179987023 21:44927716-44927738 CTGCAGGCAGGGCTGGCAGAGGG + Intronic
1180067072 21:45417892-45417914 CTGTGGGTGGGGCCTGGGGAAGG - Intronic
1180070356 21:45432757-45432779 CTGTGGGTCAGGGTGGGACATGG + Intronic
1180287747 22:10766157-10766179 CTGTGGGTAGGAGTGGGGAATGG - Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180913904 22:19472176-19472198 CTGTGGGAAGAGCTGGCAGGAGG + Intronic
1181030647 22:20147556-20147578 CCGTGGGTTGGGCTGGGTGGGGG + Exonic
1181497018 22:23293016-23293038 CTGCTGGTGGGGCTGGGACAGGG + Intronic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1181769470 22:25114860-25114882 CCGTGGCTGGGGCTGGGAGGGGG + Intronic
1181848117 22:25729720-25729742 ATGCCGGTAGGGGTGGGAGATGG - Intergenic
1182129073 22:27837580-27837602 CTGTTGCTAGGCCTGGGGGAGGG + Intergenic
1182364235 22:29767083-29767105 CTGGGCGGAGGGCGGGGAGAAGG + Intergenic
1182468123 22:30530833-30530855 CTCTGGGAAGGGCTGAGAGTAGG - Intronic
1182516500 22:30862008-30862030 CTGCAGGTAGGGCTCTGAGAAGG - Intronic
1182925044 22:34114340-34114362 TTGTGGGGAGGGCTGGTAGCTGG - Intergenic
1183192864 22:36332832-36332854 CTGTGGGTGGGGCCAGGAGGGGG + Intronic
1183357927 22:37369380-37369402 GTCTGGGTAGGTCTGGGAAAAGG - Exonic
1183370045 22:37427182-37427204 GTGGGGGTGGGGCTTGGAGAGGG - Intronic
1183380917 22:37490120-37490142 CTGTGGGCAGGGCTGAGCGTTGG + Intergenic
1183830892 22:40417895-40417917 CTGTGGCCTGGGCTGAGAGAGGG + Intronic
1183931757 22:41239524-41239546 CTGTGGGCAGCGCTGGGCGGCGG + Exonic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184061069 22:42081835-42081857 CTGAGGGTATGTCTGTGAGAGGG + Intronic
1184204321 22:42991577-42991599 CATTGGATAGGGCTGGGAAAGGG - Intronic
1184390562 22:44200992-44201014 CTGTGGCTGTGGCTGGGAGTCGG - Intronic
1184393172 22:44217422-44217444 GTGTGGGGTGTGCTGGGAGATGG + Intronic
1184885889 22:47344200-47344222 GTGTGTGTGAGGCTGGGAGAGGG + Intergenic
1185151161 22:49164691-49164713 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
1185151186 22:49164753-49164775 CTGTGGGTGGGGCTGTGGGTGGG - Intergenic
1185151196 22:49164777-49164799 CTGTGGGTGGGGCTGTAAGTGGG - Intergenic
1185151221 22:49164839-49164861 CTGTGGGTGGGGCTGTGGGTGGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185284857 22:49995647-49995669 GTGGGGGCAGGGCTGGGAGGTGG - Exonic
1185333454 22:50261652-50261674 CTGAGGGAAGGGCCGGGAGCGGG - Exonic
1185342941 22:50299736-50299758 CGGTGGGTGGGGCTGGGTGGCGG - Intronic
1185345577 22:50309197-50309219 GGGTGGGAAGGGCTGGGAGCAGG - Exonic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
949369968 3:3324297-3324319 CTGTGTGTATGGCTGTGACATGG - Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
950087996 3:10274595-10274617 CTGTGTGTAGGGGTCGGGGAGGG + Intronic
950108770 3:10405280-10405302 CAGCAGGTAGGGCTGGGAGTTGG - Intronic
950210045 3:11116556-11116578 CTGCGGGGAGCGCTGGGAGGTGG - Intergenic
950241219 3:11371623-11371645 CTCTGGGATGGGCTGGGAAATGG - Intronic
950652132 3:14413703-14413725 CCGGGGGTGGGGCTGGGGGAAGG + Intronic
950654896 3:14430471-14430493 CTGGGGGTTGCCCTGGGAGATGG + Intronic
950730742 3:14954699-14954721 CTATGGGAAGGGGTGTGAGAGGG + Intronic
951537915 3:23756378-23756400 CTGTGTGTAGGGGTGGGTGTAGG - Intergenic
952694585 3:36250365-36250387 CAGTGAGTAGGGATGGGACATGG - Intergenic
952737791 3:36707425-36707447 CTCTGGGCAGGGCTGGGATCAGG - Intergenic
953187808 3:40654608-40654630 CTGTGGGGAGAGCTGGGGAAAGG + Intergenic
954107377 3:48416519-48416541 CTGACAGTAGGGCAGGGAGAGGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954650990 3:52162580-52162602 CTTGGGGGAGGGCTGGGAGCAGG - Intergenic
954653212 3:52177858-52177880 CAGTGGGAAGTGCTGGGAGTTGG + Intergenic
955140908 3:56268833-56268855 GTGTGGAAAGGTCTGGGAGAAGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
955887279 3:63614027-63614049 CTGTGGGTAGTGGTGGCAGAGGG - Intronic
956724504 3:72145940-72145962 CAGTGGGCAGGGCTGAGGGATGG + Intergenic
956755098 3:72378020-72378042 CGGTGGGGAGGGCTGGGAGGGGG - Exonic
957060720 3:75479350-75479372 CGGGGAGTGGGGCTGGGAGATGG + Intergenic
957177684 3:76832713-76832735 ATGTGGGGAGGTCTGGGAGCTGG + Intronic
958044826 3:88271001-88271023 CTGTGGGTAGAGCTGAGGGTGGG - Intergenic
958802349 3:98770705-98770727 GTGTGTGTAGGGCTTGGAGAAGG + Intronic
960690494 3:120341911-120341933 CTAGGGGGAGGGCTGGGAGCAGG + Intronic
961303279 3:125936089-125936111 CGGTGGGCAGAGCTGGGACATGG + Intronic
961332930 3:126153650-126153672 GTCTGAGCAGGGCTGGGAGAGGG + Intronic
962249840 3:133829163-133829185 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
962406787 3:135107314-135107336 CTCTGGATAGGGATGTGAGAAGG + Intronic
962489829 3:135882403-135882425 CAGGGGGTAGGGGTGAGAGAGGG + Intergenic
963052235 3:141152071-141152093 CTGTGGGTAGGGCCGGGCCATGG + Intergenic
963054806 3:141177434-141177456 CTGGGGGCAGGGTTGGGTGAAGG - Intergenic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
963290729 3:143484568-143484590 CTGAGCCTAGGGCTGGGAGCGGG + Intronic
963430287 3:145192643-145192665 CTGGTGGTAGAGATGGGAGAGGG - Intergenic
963835880 3:150057393-150057415 GCGTGGGTGGTGCTGGGAGAAGG + Intergenic
963868849 3:150391916-150391938 GTGTGGGATGGGGTGGGAGAGGG - Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
965751516 3:171979436-171979458 CTGGAGGTCGGGCAGGGAGAGGG - Intergenic
966240589 3:177751673-177751695 CCCTGGGCAGGGCTGAGAGAGGG + Intergenic
966399592 3:179534840-179534862 CTGTGGGGAGGTCTGTGTGATGG - Intergenic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
968274957 3:197433876-197433898 CTGTGGGCTGGGCTGGGAAGAGG + Intergenic
968284864 3:197502569-197502591 CTGGGGCTAGGCCTGGGAGAGGG - Intergenic
968558311 4:1261621-1261643 CAGTGGGTAAGGCAAGGAGAGGG + Intergenic
968975830 4:3821638-3821660 CTGTGGGCAGGTCTGGCTGATGG + Intergenic
969172760 4:5377031-5377053 CTGTGGGGAGAGCTGGGGGCAGG - Intronic
969174104 4:5385915-5385937 CTGTGGGTGGGGCTGTGGGTGGG - Intronic
969174115 4:5385940-5385962 CTGTGGGTGGAGCTGTGAGTGGG - Intronic
969174122 4:5385965-5385987 CTGTGGGTGGAGCTGTGAGTGGG - Intronic
969263248 4:6046779-6046801 CTGTGGGTCGGGCGTGGGGAGGG + Intronic
969276910 4:6141995-6142017 CAGTGGGTGGGGGTGGGGGATGG - Intronic
969345394 4:6566769-6566791 TTGTGGCTAGGGTTGGGGGAGGG - Intergenic
969364682 4:6687326-6687348 CTGCAGGGAAGGCTGGGAGAGGG - Intergenic
969367226 4:6703505-6703527 TTGTGGGTAGGTTTGGGGGAAGG - Intergenic
969630480 4:8333021-8333043 CCCTGGGTAGGGCTGGGCCATGG - Intergenic
969957075 4:10902000-10902022 CTGTCGGTAGGGCATGGAGAGGG - Intergenic
970371563 4:15412311-15412333 GTGGGGGTGGGGGTGGGAGATGG - Intronic
972366985 4:38385387-38385409 TTGTGGGTAGGGCCGGCAGTAGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975798829 4:78037053-78037075 CAGGAGCTAGGGCTGGGAGAAGG - Intergenic
976140330 4:81984930-81984952 CTGTGGGTTGGGGTGACAGATGG - Intronic
976613142 4:87050212-87050234 CTCTTGGTAGAGCTGGGAGAAGG + Intronic
979202270 4:117992867-117992889 CAGTGGGGAAGGGTGGGAGAAGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
982455181 4:155601391-155601413 CTGTGGGAAAGGGTGGGAGGAGG - Intergenic
984029063 4:174580816-174580838 CTGTGGGTGGTGCAGGGAGGAGG + Intergenic
984678340 4:182576989-182577011 GTGTGGGTGGGGCTGGGACAGGG - Intronic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985635052 5:1031771-1031793 CAGTGGGCAGTGCTGGGAGCAGG + Intronic
985669996 5:1202136-1202158 CTGAGGGTGGGGCCGGGGGAAGG + Intronic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
988845161 5:35120119-35120141 CAGTGGGTAGAGCATGGAGATGG + Intronic
989137194 5:38167213-38167235 CTGTGGTGAGGCCTGGGGGAGGG + Intergenic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
989397371 5:40972166-40972188 TTGAGGGGAGGGGTGGGAGAGGG + Intronic
990945944 5:61249619-61249641 CTATCGGGGGGGCTGGGAGAGGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992438256 5:76775791-76775813 GTGTGGCTGGTGCTGGGAGAAGG - Intergenic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
994358795 5:98826525-98826547 GTCTAGGCAGGGCTGGGAGAGGG + Intergenic
994625995 5:102219793-102219815 CTGGGGGAAAGGGTGGGAGAGGG - Intergenic
996111383 5:119570374-119570396 CTGTGACTAGGACAGGGAGAAGG - Intronic
996909866 5:128643450-128643472 GTGTGCGTGGGGCTGGGGGAGGG + Intronic
997009861 5:129863097-129863119 CTCTGGATAGGGCCTGGAGAAGG + Intergenic
997209659 5:132069898-132069920 CTGCGGCTAGGGCTGGGCAAGGG + Intergenic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997432081 5:133847715-133847737 ATCTGGGTATTGCTGGGAGATGG - Intergenic
997691588 5:135831061-135831083 CTATGAGGAGGGCAGGGAGAGGG + Intergenic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998534233 5:142914649-142914671 CTGTGTGTAGAGGTGTGAGAGGG + Intronic
998541319 5:142984144-142984166 CTGTGGTTCAGGCAGGGAGAAGG + Intronic
999053242 5:148546573-148546595 CTGTGGGCAGCCCTGAGAGAAGG - Intronic
999423326 5:151464198-151464220 CTGTGGGAAGAGCTGGGCTAAGG - Intronic
999818975 5:155205539-155205561 CGGAGGGTGGGGCTAGGAGAGGG + Intergenic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000241474 5:159412514-159412536 CTTGGGGTAGGGCTGGGAGGGGG - Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001148274 5:169203857-169203879 CTGTGGGTAGAGCAGGGGGTTGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001629005 5:173160644-173160666 GTGTCGGCAGGGCTGGGTGAGGG + Intronic
1001631276 5:173177504-173177526 CTGTGATGAGGGCTGAGAGAAGG + Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002067503 5:176659450-176659472 CTGCAGGGAGGCCTGGGAGAAGG + Intergenic
1002068505 5:176664764-176664786 CCTGGGGGAGGGCTGGGAGAAGG + Intergenic
1002684402 5:180996688-180996710 TTGTGGTCAGGTCTGGGAGAGGG - Intronic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003923479 6:10855618-10855640 TTGAGGGTAGGGCTGGGGGGAGG - Intronic
1003936085 6:10976683-10976705 CTGAGTGTAGGGCTGGGAATGGG - Intronic
1004259555 6:14096178-14096200 CACTGGGTAGGGGTGGGTGAAGG + Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006334875 6:33415250-33415272 CTCTGGTTAGGGCTGGGGGATGG - Exonic
1006473827 6:34242869-34242891 CTGTGGGGAGGTCTGGGAAGGGG + Intronic
1006503972 6:34476402-34476424 GTGTGGGGAGGGCTGGGGAAGGG - Intronic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006595144 6:35187452-35187474 CTGTGGGGAGAGCAGAGAGATGG - Intergenic
1007076091 6:39067132-39067154 ATGGGTGTAGGGCAGGGAGAGGG - Intronic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007784012 6:44270283-44270305 CAGTGAGCAGGGCTGGGAGCGGG + Intergenic
1008016669 6:46528119-46528141 ATGTGGGTTGTGCTGGGAGGAGG + Intergenic
1008192894 6:48481865-48481887 ATGGGGGTAGAGGTGGGAGATGG + Intergenic
1008674218 6:53802324-53802346 CTGTGGGATGTTCTGGGAGATGG + Intronic
1008717351 6:54305284-54305306 CTGGGAGTAGGGGAGGGAGAAGG + Intergenic
1008881772 6:56387558-56387580 CACTGAGGAGGGCTGGGAGAGGG - Intronic
1009738892 6:67718200-67718222 CTGAGAGTGGGGCTGGAAGATGG + Intergenic
1009994964 6:70887501-70887523 CTGTGAGTGGGGCTGAGTGACGG - Intronic
1011377156 6:86701244-86701266 CTGTTGGGGAGGCTGGGAGAGGG - Intergenic
1011786292 6:90848953-90848975 TTGGGTGTAGGGCTGGTAGAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012836168 6:104271068-104271090 CTTTGGTGTGGGCTGGGAGAAGG - Intergenic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1014109823 6:117608066-117608088 CTTTTGGTAGGGATTGGAGAGGG + Intergenic
1014207863 6:118676322-118676344 ATGAGGGTAGGGTTGGGAAAAGG - Intronic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015249505 6:131112428-131112450 GTTTGCCTAGGGCTGGGAGAGGG - Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015798254 6:137034558-137034580 CTGTGAGGAGTGCTGGGGGAGGG - Intronic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016502578 6:144738358-144738380 TTGGGGGTAGGGGTGGGTGAAGG - Intronic
1017859056 6:158378487-158378509 GTGGGGGTGGGGGTGGGAGATGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018733863 6:166673021-166673043 CTCTGGGGAGGGCTGGGAGAGGG - Intronic
1018787038 6:167116496-167116518 AGGTGGCTTGGGCTGGGAGAAGG - Intergenic
1019978462 7:4603284-4603306 CTGTGGCTTGGGCTGCTAGAAGG - Intergenic
1020026888 7:4905660-4905682 CTGGGCCTGGGGCTGGGAGAGGG - Intergenic
1021056458 7:16053316-16053338 GTGTGGGTAGGGGTGGGAGGTGG - Intergenic
1021970686 7:25962934-25962956 GTGTGGGAAGGGCTGAGAGGTGG + Intergenic
1022250872 7:28607104-28607126 GTCTGGGAAGGGCAGGGAGAAGG - Intronic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1023582911 7:41700926-41700948 CTGTGAGTAGGGCTGTGATTAGG + Intronic
1023772026 7:43566536-43566558 GTGTGGGGAGGACTGGGAGAAGG + Intergenic
1024525958 7:50349589-50349611 CTGTGGGGAGGGCTGGCAGCAGG + Intronic
1025209531 7:57012969-57012991 TTGTGGGCAGGGCTGGGTGGTGG - Intergenic
1025662417 7:63563881-63563903 TTGTGGGCAGGGCTGGGTGGTGG + Intergenic
1026008503 7:66618377-66618399 GGGTTGGGAGGGCTGGGAGAAGG + Intergenic
1026255833 7:68710278-68710300 TTGAGGGTAGGGTTGGGGGAGGG + Intergenic
1026840423 7:73667759-73667781 CTGGGGGTGGGGCAGGGAGGAGG - Intergenic
1026848753 7:73712038-73712060 ATGAGGGTAGGGCTGGGGAAAGG + Intronic
1027187186 7:75979615-75979637 CAGTGGGTAGGACAGGGAGCAGG + Intronic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028853490 7:95563718-95563740 CTGGGGCTAGGGGTGGGAGCAGG + Intergenic
1028982212 7:96979731-96979753 TTGTGTGTTGGCCTGGGAGAGGG - Intergenic
1029168905 7:98617301-98617323 CGGTGGGTGCGGCTGTGAGACGG + Exonic
1029432821 7:100542633-100542655 CTGTGGGAAGGAGTGGGAGCTGG + Intronic
1031976713 7:128098511-128098533 CTGTGTGTTGGTCTGGGAGGTGG + Intergenic
1032388344 7:131539678-131539700 CTGAGGGCGGGGCTGGAAGAAGG + Intronic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1032657830 7:133951177-133951199 CCATGGGTAGGGCTGGGTCAAGG - Intronic
1033212126 7:139467801-139467823 CTGGGTGTCGGGCTGGGGGACGG - Intronic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034439735 7:151080649-151080671 CTGCGGGGAGGGCTGCGGGAGGG - Intronic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034867690 7:154656171-154656193 GTGGGGGGAGAGCTGGGAGAAGG + Intronic
1034867703 7:154656210-154656232 GTGGGGGGAGAGCTGGGAGAAGG + Intronic
1034867716 7:154656249-154656271 GTGGGGGGAGAGCTGGGAGAAGG + Intronic
1034867753 7:154656366-154656388 GTGGGGGGAGAGCTGGGAGAAGG + Intronic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035293521 7:157854764-157854786 TTGTGGGAAGGGCTGGGAGGAGG + Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035534245 8:378986-379008 GTGTCTGTAGGGCTGGGACAGGG - Intergenic
1035559388 8:593490-593512 CTGAGGGGAGGGATGTGAGAGGG + Intergenic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1038536549 8:28357266-28357288 CTTGGGGGAGGGGTGGGAGAAGG - Intronic
1038704501 8:29880952-29880974 CTGGTGGTAGGGGTGGGAGTGGG + Intergenic
1039027622 8:33275095-33275117 CAGTGGGAAGGGCTGGGTGATGG - Intergenic
1039462257 8:37755100-37755122 CTGTGGCTTGTGCTGGGAGTGGG + Exonic
1039551301 8:38445066-38445088 CATTGGTTAGGGCTGGGACAGGG - Intronic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1042552018 8:70002635-70002657 CTGGGGCTAAGGTTGGGAGAGGG + Intergenic
1042680889 8:71381769-71381791 GTGTGTGTAGGGGTGGGAGGGGG - Intergenic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1044871632 8:96625667-96625689 GTGTGTGTTGGGCTGGGAGTGGG - Intergenic
1046587447 8:116165035-116165057 GTGAGGATAGGGCTGGGAGGAGG + Intergenic
1047166416 8:122444288-122444310 CTCTGTGTGGGCCTGGGAGATGG + Intergenic
1047249222 8:123169134-123169156 CTTTGGGGAGGGCTGGGAAAAGG + Intergenic
1047793989 8:128235253-128235275 CTGGGTGGAGGTCTGGGAGATGG + Intergenic
1047803217 8:128331347-128331369 CTGTGTGAAGTGCTGGGAGTTGG + Intergenic
1049031461 8:140041136-140041158 TTGCGGGTAGGGCTGGGTCAGGG - Intronic
1049305920 8:141903894-141903916 CTGTGGGGAGTGATGGGAGGAGG + Intergenic
1049320521 8:141993815-141993837 TTGGGGGAAGGGCTGGGGGAGGG - Intergenic
1049348990 8:142154076-142154098 CTGTGGGGAGAGCTGCAAGAGGG - Intergenic
1049412696 8:142480415-142480437 CTGTGGGGAGGTGTGGGGGACGG + Intronic
1049579842 8:143406344-143406366 CTGTGGGTAGAGGTGGGGGTGGG - Intergenic
1049621935 8:143602371-143602393 CTGCAGGTAGGGCTGGGACGGGG - Exonic
1049733179 8:144189575-144189597 CTGAGGGCAGAGCTGGGAGCGGG - Intronic
1049994941 9:1025801-1025823 CTGTGAGTAGTTTTGGGAGAGGG - Intergenic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050280310 9:4043500-4043522 CTGTAGGAAGGGCTGGGAAGGGG + Intronic
1051889591 9:21928400-21928422 CTCTGGGGAGGACTGGTAGATGG + Intronic
1052250746 9:26394299-26394321 CCTTGGGAAGGGCTGGCAGATGG + Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052557993 9:30044859-30044881 TTGTGGGTAGGACTGTGAGTTGG + Intergenic
1052861639 9:33441447-33441469 ATGTGGGTAGGGCTGGGAGGAGG - Exonic
1052943681 9:34150170-34150192 CAGAGAGTAGGACTGGGAGATGG + Intergenic
1053129830 9:35608615-35608637 CTGGGGGTCGGGCTGGGGTAGGG + Intronic
1053199801 9:36144651-36144673 ATGTGGGCAGGGCAGGGATATGG - Intronic
1054934402 9:70671333-70671355 CTGTGGGTAGGAGTGGGAGCTGG + Intronic
1055640755 9:78317003-78317025 CTCTGGGTAGGGGTGGGATTGGG + Intronic
1055656885 9:78459563-78459585 TTGTGGGGAGGGTTGGGAGAAGG + Intergenic
1056192118 9:84194781-84194803 CTTGGGGGAGGGCTGGGAGCAGG - Intergenic
1056417235 9:86388499-86388521 CTGTGTCCAGGGCTAGGAGAGGG - Intergenic
1056651221 9:88465395-88465417 CTGTAGGTAGGACTGGAAAATGG - Intronic
1056710766 9:88990855-88990877 CTGGGGGTAGAGCGCGGAGAGGG + Intronic
1057652628 9:96931802-96931824 CTGTGTGTTGGGCCGGGAGAGGG - Exonic
1057724416 9:97558032-97558054 TTGTGCCTAGGGCTGGCAGAAGG + Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059651230 9:116318206-116318228 CTGAGGGAGGGGCTTGGAGAAGG - Intronic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060436235 9:123595490-123595512 CTGTGGGTAGATCTGAGAAAGGG + Intronic
1060821241 9:126662651-126662673 GTGTGGGCTGGGCTGGGAGCCGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060985029 9:127814992-127815014 TGATGGGTTGGGCTGGGAGAAGG - Exonic
1061136889 9:128739908-128739930 GTGTGGGCAGGGCAGGGAGCGGG - Intronic
1061222326 9:129259303-129259325 ATGGGGATGGGGCTGGGAGAAGG - Intergenic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320263 9:129823855-129823877 CTGGGGCTGGGGCTGGGCGATGG - Intronic
1061809004 9:133151700-133151722 CTGGGTGGATGGCTGGGAGATGG - Intergenic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1062217536 9:135397383-135397405 CTCTGGGAGGGGCTGGGAGCAGG - Intergenic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062511890 9:136910798-136910820 AAATGGGTAGGGCTGGGGGACGG + Intronic
1185464344 X:346049-346071 GTGGGGGTGGGGGTGGGAGAGGG + Intronic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1186357211 X:8800898-8800920 CAGTGGGTAGGGGTGGGGCAGGG - Intronic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1187361173 X:18628794-18628816 CAGTGGGGAGGGGTGGGAAAGGG + Intronic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187557958 X:20370078-20370100 CTGAGGGTAGGGTTGGGGGCTGG - Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188512469 X:30950969-30950991 CTGTGGTGAGGGCCAGGAGATGG - Intronic
1190212761 X:48460953-48460975 CTGGGGCTAGGGCTGGGGGGAGG - Intronic
1190466468 X:50729007-50729029 TTGGGGGTGGGGGTGGGAGATGG + Intronic
1190916705 X:54816566-54816588 TTGTGGGAAGGCCTGGGAGAAGG + Intergenic
1190944405 X:55076805-55076827 CTGTGTGGAGGGGTGGGACAAGG + Intronic
1190945649 X:55090738-55090760 CTGTGTGGAGGGGTGGGACAAGG + Intronic
1190958594 X:55222003-55222025 CTGTGCGGAGGGGTGGGACAAGG + Intronic
1191672816 X:63764806-63764828 TTGTTGGTGGGGCTGGGGGAGGG + Intronic
1191959345 X:66682888-66682910 CTGTGGCTAGGGCAGAGTGAAGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192244554 X:69361781-69361803 GTGGGGGCAGGGGTGGGAGATGG + Intergenic
1192537266 X:71938858-71938880 CTGAGTGTATGGCTTGGAGAAGG + Intergenic
1192762584 X:74109097-74109119 TTGTGGGGAAGGGTGGGAGAGGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194525966 X:94977922-94977944 CTGTTGGTATGGCAGGGGGAGGG + Intergenic
1194688163 X:96950474-96950496 CAGTGGGTGGGGCAGGGAAAAGG - Intronic
1195167916 X:102238717-102238739 CTGGGGGTTGGAGTGGGAGAGGG - Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195190941 X:102448370-102448392 CTGGGGGTTGGAGTGGGAGAGGG + Intronic
1195604721 X:106792359-106792381 CTGTGGGTAGGGGTGGGGTGGGG + Intronic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196118215 X:112019850-112019872 CTGTTGGAAGGGCTGGAAAATGG + Intronic
1196213842 X:113027412-113027434 ATTTGGGTAGGGCAGGGACAGGG + Intergenic
1197487423 X:127071085-127071107 TTGGGGGTAAGGCTGGGAGAGGG - Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1197699557 X:129588568-129588590 CTGTTGACAGGGCAGGGAGAAGG + Intronic
1197967331 X:132079007-132079029 ATTTGGTTAGGGCTGGGGGAGGG + Intronic
1198178069 X:134174572-134174594 CTGGGAGGAGGGGTGGGAGATGG - Intergenic
1198287864 X:135210318-135210340 CCGTGTGTAGGACTGAGAGAAGG + Intergenic
1198394610 X:136208927-136208949 CTGGGGGGAGGGGTGGGAGGAGG + Intronic
1198409441 X:136350888-136350910 CTGCAGGTAGGGATTGGAGAAGG - Intronic
1198955625 X:142126272-142126294 CTGTAGGAAGGGCTGGCTGATGG + Intergenic
1198958465 X:142157851-142157873 CGGAGGGTTGGGGTGGGAGAAGG + Intergenic
1199111412 X:143939774-143939796 CAGAGGGTAGGGGTGGGAGGAGG + Intergenic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200077298 X:153557501-153557523 TTTTCGGTAGGGCAGGGAGAGGG - Intronic
1200102367 X:153694458-153694480 CTGAGGGCTGGGCTGGGGGATGG + Intronic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic
1202378593 Y:24258550-24258572 ATGGGGGAAGGGCTGGGAGGAGG + Intergenic
1202492189 Y:25411571-25411593 ATGGGGGAAGGGCTGGGAGGAGG - Intergenic